ZFIN ID: ZDB-TSCRIPT-090929-14982
Transcript Name: hsd3b1-201
Previous Names: hsd3b1-001, ottdart00000034079, si:rp71-68n21.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034079 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034079|OTTDARG00000025808|ZDB-GENE-081105-30 hsd3b1|OTTDARP00000027506 RP71-68N21.10-001 LG_ BX511129.15 Danio rerio protein_coding NOVEL, 1535 bp
GGACTTGTTACACCTCTGAGTTCTCCAGTCCCTGCTCACT
CGAACAATTCCATCAGAGTGGCAAAACCCAGCAGTGAATT
GGCATTGCTGGCAGTTTCCATGGCTCTTTCAGGAGAAGTG
TGTGTGGTGACAGGAGCCTGCGGGTTTCTTGGAGAAAGGC
TGGTTCGACTGTTGCTGAAGGAGGAGAAGCTTGCTGAGAT
CCGACTGCTGGATAGAAACATCCGCTCTGAGCTAATACAG
TCTCTTGATGATTGCCGGGGAGAGACTAAAGTGAGTGTTT
TCGAGGGCGATATCAGGAATCCTGAGCTGCTGAGGAGAGC
TTGTAAAGGAGCAGCGCTTGTTTTTCACACTGCGTCTCTC
ATTGATGTCATTGGAGCAGTTGAATACAGTGAACTGTATG
GAGTTAATGTCAAAGCAACAAAGCTGCTGCTTGAGACATG
CATCCAAGAAAACGTACCCTCCTTCATTTACACCAGCAGC
ATTGAGGTGGCTGGTCCCAATCCCAGTGGTGAACCAATCA
TCAACGGCAATGAGGACACCCCATACTCCTCTCGCCTTAA
ATTCAGCTACAGCAAAACCAAAAAGGAGGCCGAAGAGATT
TGCCTGCAGGCCAATGGAGATCTGCTGTGTAATGGAGGTC
AGCTCGCCACCTGTGCACTGAGGCCCATGTACATTTTTGG
ACCAGGCTGCCGATTTACTTTAGGCCACATGAGGGATGGA
ATCCGCAATGGAAATGTGCTGCTGCGAACCTCACGCCGTG
AGGCTAAAGTGAATCCTGTATATGTGGGAAACGCAGCCCT
GGCACATCTACAAGCAGGACGGGGACTCAGAGATCCTCAG
AAAAGGGCCATGATGGGAGGAAACTTCTATTACATCTCAG
ACAACACGCCACATGTCAGCTATTCGGACTTTAACTATGC
TGTTCTGTCCTCTTTAGGCTTTGGGATACAAGAGAGGCCA
ATTCTGCCCTTTCCGCTCCTGTATATTCTTTCTTTCTTCA
TGGAGTTGCTGCACGTTGTGCTCCGACCCTTCCTAACGTT
TACTCCACCCTTAAATAGGCAGCTACTGACCATGCTTAAC
ACGCCTTTTAGTTTCTCATATCAAAAGGCTCACAGGGATT
TCGGCTACACCCCTCGCTATGAATGGGAAGAGGCGCGCAA
ATGCACTACTGATTGGTTTGCATCTGTCTTACCTGCAGAA
ATACGATCAATTAACTTGAAATAAACTCGCATGTTGTTTA
TGACTTTAACTGCCTGTTGGTTAAACGTGCCAGTGTTTAA
TAATTCAATATATTGTGATAAGGAACAAGCATGGTTCAGA
TCAGTTGTGTTTTTTAAAGTAACATTAACAAAACTTCTGT
AACAAATGTAGCTATTTCTTACTATTGATGTTAGTTATTA
TAGTGCATTAACAATTACTAATGAGACCTTATTGTTAAAC
ATTACCTATTGTATCTTTATAAACCCTTTGCTATTAAATT
AGTTTGAAGTTTTTTGCTCTGAGCATTTACATAAATTATT
ATACCTGTTAAAGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hsd3b1-201 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000034079 (1),  Ensembl_Trans:ENSDART00000061321 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC074074 (1) 1550 bp
GenBank:EL646556 (1) 953 bp
GenBank:EH538581 (1) 930 bp
GenBank:EB909597 (1) 582 bp
CITATIONS (2)