Transcript

alcama-201

ID
ZDB-TSCRIPT-090929-1462
Name
alcama-201
Previous Names
  • alcam-001
  • alcama-001
  • ottdart00000009308
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009308 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009308|OTTDARG00000008167|ZDB-GENE-990415-30 alcama|OTTDARP00000008021 alcam-001 LG_ BX005366.19 Danio rerio protein_coding KNOWN, 3112 bp
GGAGCTGCCTGCCGACGGTTATAGGTCTGTACGGTGAGAC
CATCGAAGTGCCATGCAACAATGGAAATAACAAGCCAGAT
GGCCTTATTTTCACCAAATGGAAATATGTGAAAGATGACG
GCTCCCCTGGCGATCTACTAATAAAGCAGGCACAGAAAGA
TGATCCGACTGTGTCTGCCATGGACGGCTACAAAACTAGA
GTTAGCATCGCTGCTAATTCCAGCTTACTGATTGCCCAGG
GCTCTTTGACTGACCAGAGAGTCTTCACCTGCATGGTGGT
GTCTTCAACTAATCTGGAGGAATTCTCTGTGGAAGTTAAA
GTTCACAAAAAACCATCAGCCCCTGTAATCAAAAACAAAG
TGAAAGAACTGGAAAATGGCAAACTGACGCAGTTGGGGGA
ATGTGTGGTGGAGAGCGCCAACCCAGCAGCAGATCTCATC
TGGATGAAGAACAACCAGGCTCTGGTGGATGATGGCAAGA
CGATCATTATCACATCAGATGTCACCAAGGACCCAGTCAC
CGGTCTGTCCAGCACCTCTTCCAGACTGCAGTACACAGCA
AGGAAAGAGGATGTGGCATCACAGTTCACCTGCGTTGCAA
AGCACGTGACGGGACCCAACCAGGTTTCAACACCCGATAC
CTTCCAAATTCGCTATCCCACTGAGAAGGTGAGTCTACAG
GTTGTCTCTCAGAGCCCCATTAGGGAAGGTGATGATGTGA
CTCTGAAATGCCAGGCGGACGGAAACCCTCCTCCTACCAG
CTTCAACTTTAACATTAAGGGAAAGAAGGTCACGGTGACG
GACAAGGATGTCTACACACTGACCGGCGTCACCCGAGCCG
ACAGCGGTGTGTACAAGTGCTCTCTGCTTGACAACGATGT
GATGGAGTCCACTCAGATCGTCACAGTGAGCTTTCTGGAT
GCAAGCCTCACTCCTACAGGCAAGGTGTTAAAAAAGCTCG
GGGAAAACTTGGTAGTGTCTTTGGAGAAGAATGCCTCTTC
TGAAGTAAAAGTGACGTGGACTAAGGATAACCGTAAACTG
GACAAACTGCCTGATTTCTCCCAGTTGAGATACAGCGACG
CGGGCTTATACGTGTGTGATGTGTCCATTGAAGGAATCAA
ACACAGCTTTTCCTTCGAGCTTACTGTGGAAGGTGGTCCA
AGAATTACCGGCCTGACAAAGCATCGCAGCAATGACGGAA
AACACAAAGTGTTGACGTGCGAGGCAGAAGGTTCACCTAA
ACCTGAAGTGCAGTGGAGTGTCAACGGAACCGACGATGAA
ACATCGTATGTCAACGGAAAAGCCACATACAAACTGACGG
TGGTCCCGAGTAAGAACCTCACCGTCAGCTGCCTCGTGAC
CAATAAACTCGGTTTCGACACAAAGGACATCAGCGTGTTT
TCCCTATTTGAGGAGGACAAGCCCAAACCAGGAAAAAATG
AAGATGGCGCAGACCAGGCCAAAGTGATTGTGGGTGTCGT
GGTTGGACTGTTTCTAGCCGCTGCCCTGGTGGGACTCATC
TACTGGTTGTATATCAAGAAAACAAGACAAGGCAGCTGGA
AGACCGGAGAGAAGGAGACTGGCACTTCAGAGGAGAGTAA
GAAACTGGAGGAGAACAATCATAAAGCAGATGTCTAAGAG
TGGAGAGAGCCGTCAAACGGAACGAAGAAGGTTTGAACCA
GGAAAGAGGCCTTGTCACACTGAATGTGCAGTACTACACA
CTTCGATCATCTTATTCCAGACATCTGATTGGACGGCGAC
GCCTCCTTCTGGCTGCTCGTGCGCATACCGCATCGCAGAA
TGTTTCCAAAATATTTCCTACTCCAAACAAACAATTTCCT
AAAAAAGAAAAAAAGCAAAGAAAAAAAAAGAAAGAAAGAA
AGAAATCCCACCACCACGATCCAAGAGTGTAAAACCACTT
GTGTTGTAAATTTAGTCTGCACTGAGGACTGCTTTTATTT
TTGATCGATTGCGATGTTTTCTTTTTGTGTTCCCCGTGAA
TGTTCTTCGTTTCATACGCATTGCTGATGTGGTGGGCACA
GCCGTTTTGTTTCCCTTCTAGTATTAAAAAAAGAAAATGT
AAATTCGCTGTACACTTTTTAGGCCTGTGTAAATAAGTCA
GGGGAGTGCATTCACTCTGCTTAACGTTGGGATTATTATT
ATTTAAAAAAAGAATAAGGATTGTGGGACTACATATCGAA
ACTGCACAGTCCCTTCGGAAAAACAAACACCCAAGATCGC
AGTCGGATGCTGGAAGAACGATGACTTCACTGCTGTTACA
CCTCTGTTCGCTCATCTTTTATTTATTGATACCTCTTCAT
GTTGTTTCCTCTAGTTCGAAAGTGGCTAAGTAGTGAAACG
GGTTTAGACAATTAGCATAGCATAGGGAAATATCCTGCTA
CACCCAGTGGCCTTCAGGTTGCACTGCATGATGTCATAGT
TGTAGGAGTTCAGCAGAATCCAACGTAGCGACTTAGACGT
GCATTCAATAGAAATAAGCAAACATCCCACTCTCGGTTTC
AATCTGGGTGCTAGCAACCTTGCATGCAGAGCCTTTATTT
TTGTGGGTAGGAAGTAAACTATTAAAGGATAGCCCCTTAT
TCTGCCTTAACAGAAAGAGTTGGAAACGAATCCAAGTATG
TTAATGTGAAACCTCACTGTATAGCCTTTTCGGTTTTGCA
CTTCCCTCAGACTACATTTCATTTTCTGTATGTAAAGCAT
TTGTCAGGTTGATGTCCTACACTGTAGTCTTTAGGGATGG
TCTGAAGCGATTGTTTTTCCGTTCATTGTGGTCTGAAGAA
GCTGTAAATATGTTTGACTTGTGTTCGGCTATTTATAAAA
GTGTGAGAAGGATAGCTGTGCTTCTGCTTAGTCACTAAAG
AGACCCTTTTCAGTTCTAATGTACTCATCACGGATGTTTC
GAAGAAATCTAGCGCTCACTTTTTTGTTTTGCTCCACAAA
ACGAGTGTTTTGAATGTTCACGCATATTTTGAACCATCAG
GTCAGCAGTGAAACCAAAGAGGGTAACCGCAAAAGAAGGC
CATAAAGTATTGTAAATACTGACTTTTGTTTTTGTACTTT
TGTTGACAATAAAAGTGTAAATTTTAATTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations