Transcript

igf2bp2a-201

ID
ZDB-TSCRIPT-090929-14570
Name
igf2bp2a-201
Previous Names
  • igf2bp2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033620 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033620|OTTDARG00000025558|ZDB-GENE-070912-44 igf2bp2a|OTTDARP00000027214 CH211-125M20.1-001 LG_none CR936497.9,CT737147.6 Danio rerio protein_coding NOVEL, 2707 bp
ATGAACAAACTCTATGTGGGCAATCTGAGTCCTTCGGTGA
CCGTGGAGGACCTGAAGCAGCTCTTCGGCGAGAGGAAGCT
GCCCGTGACCGACCAGGTCCTGCTCAAATCCGGCTATGCC
TTCGTGGACTTCCCCGACCAGAACTGGGCGATTAAAGCCA
TCGAGACGCTCTCCGGGAAAGTTGAATTACATGGGAAAGT
GATCGAGGTCGACTACTCTGTTCCTAAAAAATTGAGGAGT
CGGAAGATTCAGATCCGGAACATTCCTCCTCATCTCCAGT
GGGAGGTTTTGGACAGCTTATTAGCACAGTATGGTACTGT
AGAAAATGTGGAGCAAGTTAACACTGACACTGAAACAGCA
GTGGTGAATGTGACGTACTCGACGAAAGAGGAGGCTAAAG
TAGCTGTGGAGAAGTTAATAGAACAGACGTTTGAGGATTA
CTCCTTTAAAGTGTCTTATATCATGGATATGGATGCTGCT
GCAGCTCTGCCTGGGACCCGGAATCGCCGGGGGGGAAGGA
CCTCACGGGAGCAGGACTCTCAGCCTGGGACGTCTGGAAG
CTCCCTGGGATCCCGGCAGAAGCAGCCAGATTTCCCCCTG
CGCATGCTGGTGCCCACACAGTTTGTGGGAGCCATCATTG
GCAAAGAGGGACTCACAATCAAGAACATCACCAAACAGAC
GCAGTCGAAGGTGGACATCCATCGCAAGGAGAACGCAGGA
GCGGCAGAGAAACCCATCACCATTCACTCCACCCCTGAGG
GCTGCTCCACCGCGTGCCACATGATCATGGACATCATGCA
GAAAGAGGCTGTAGACACAAAGGTAACTGAGGATATTCCT
CTGAAGATCCTGGCCCACAACAGCCTGGTCGGAAGACTGA
TCGGGAAAGAGGGCAGAAACCTGAAGAAGATTGAAGAGGA
CACAGAGACCAAAATAACCATCTCCTCTTTACAGGACTTA
ACGATTTATAACCCGGAGAGAACCATTATAGTGAAGGGGA
GCATCGAGGCCTGTTGTAGGGCCGAGGTGGAGATCATGAA
GAAGCTGAGGGAAGCCTACGAAAACGACGTTGCTGCTATT
AACCAACAATCCAACCTTATCCCTGGGTTGAGCCTGAGCG
CCCTGGGCATCTTTTCAACCGGTCTGTCAGTGTTGCCACC
AGCTGCTGGACCCAGAGGCATCCCACCCGTACCCCCAACC
GGCTACAACCCTTTTCTTGGTCACTCATCACAGCTGGGTG
GTCTGTACGGCGTCCCACCTGCCAGTGGCATCTCTCACCA
GCACACAGCTCCTGAACAGGAGGTGGTCTACCTCTTTATT
CCAACTCAGGCTGTTGGTGCTATTATTGGCAAGAAGGGCC
AACATATAAAACAACTGGCGCGATTTGCAGGAGCCTCTAT
TAAGATCGCTCCCGCAGAGAGTCCTGATGTCACTCAGAGG
ATGGTCATCATCACTGGCCCACCAGAAGCTCAGTTTAAGG
CGCAGGGCAGGATATTTGGAAAACTGAAAGAGGAGAACTT
CTTTACTGCAAAAGAAGAAGTAAAGCTGGAGACGCATATA
AAAGTGCCATCTTCAGCAGCTGGGAGGGTTATAGGGAAAG
GAGGGAAAACGGTGAACGAGCTGCAGAACTTAACCAGTGC
AGAGGTCATAGTGCCACGGGACCAAACCCCAGACGAGAAC
GATGAAGTGTTTGTCAAAATCAGTGGACATTTCTTTGCCA
GCCAGACTGCACAGAGGAAAATCAGGGAGATCATCCAGCA
GGTGAAACAACAGGAGCAGAAGCACCAGCAAGGCGCACCC
ACAACACCCCGCTCCAAGTGACCATCAGGGCAGCCCCAGC
GGGCACCTGCCAATGAATGTAGCCCTCCCAACTGGAACCA
GACCAGACCGGGCACAGGGGACCGGCCGGGCAGACCAGCA
GCCGTGGGATCAAAACCAAAGAACTTCTTTCTAGGGGAGA
TGAAGGAGCCACAGGCCGAAGGGCTCTGAATGCACTGCCA
GCTTGGGGAGGGAGGGACGGGGAGAGGGAACGCCAGGAAG
ACAATTGTTCAAAAACAACCCTGAGTATGAGAAGAACAGG
TAATGGGGGAAATCACGCTCACCCCATTTAACAATTTTCT
TTATAACCTCCTTAATTTAGGCTTAATCTAGGGTTAACAC
AGATGAGAAGCTCCATTAACACATGTACACTGATGCATTT
TGACTGAGTTGTGTTGCTGTTTTCTTGGGTAGGTAAAGTG
GGTGTGCACTAGCAGATGGTAACCGATTTTAGTTTTTTTC
AGATTGCTATTTCAATGATCCTCAGCAGTATTCAATACAC
TAGAACAAAATACTGTTTTACGAAGCGGGAGTTCGGTTCT
GGCACAAGCCATCGAGCGTGTAGTGCACATATTTTCAATT
TCTTTTGACGATGGGACGTGAACGTTGGGAAATGTTAATG
AAGAACGTTTACTCTTATCTTAGTCTGCATTTCAGGATAC
ATATAGCGCCACAGATTTTTGTTACTTAGGCCTGTGCGTG
GCGTCGGATGCCGTTGAAACATTTCTTACTTTCGTTTTTT
TAGCTTTTATCGTTTGTACTTCTATTCAGCTCTTACACTC
CCTTTTCATTTTCGTTTTTTACACCAGTGTTTTTTGCAGT
TGGTAAATTTTACCTCTGCCATGTTATCATGGCGAAAGTC
ATTGCGAGACGGGCTTGGTATGTAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations