Transcript

cbll1-202

ID
ZDB-TSCRIPT-090929-1456
Name
cbll1-202
Previous Names
  • cbll1-001
  • zgc:55308-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009292 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009292|OTTDARG00000008153|ZDB-GENE-040426-691 cbll1|OTTDARP00000008011 cbll1-001 LG_ BX649534.9 Danio rerio protein_coding KNOWN, 1769 bp
GGATCGACTCGAGGGTAAAAACCAAGTTGTTTTCACCCTA
CTTCCTCAGACAATGATATGCAGGGTACGGATGGGCCGTT
AGGTGGTCCTGATGTCAGGAGGAGGATCCCAATCAAACTT
CTTCCAAAGCAGGCCAGAAATAAACCTGCCCCACGACCCC
AGAGACCAACGGGACGGTTACCATCCAAAAGCCATTCTGC
AGAGGAAGGTTTTAACTTCAAGAAGGAGGACCGGTTTGAT
TGTGGTGTCAAATCAGGAGATGCTTTTGCAAGCCAGCGTC
GCTTCCCACAGCAACTTTACTGGGATTACAAGCTAAACTT
GGTCGGTGAGAAGGATGAGACGCCTGTTCATTTCTGTGAC
AAATGTGGACTGCCGATTAAAACATACGGCCGCATGATCC
CATGTAAGCACGTTTTCTGCTATGACTGTGCTTTACATCA
TGAGAGGAAGGGTGATAAGATGTGTCCAGGTCTAAATATG
TACAGCTGTACAGACCCGGTCCAGCGGATTGAGCAGTGCC
AACGTGGCTCTCTCTACATGTGCAGTATTGTTCAGGGTTG
CAAACGGACCTATCTGTCCCAGAGGGACCTGCAGGCCCAC
ATCAACCACCGGCACATGCGCTCTGGCAAGAGCTCCAGCA
GCCGCTCTGACTCTCTCCACCTTCCTCCCTCTGAAGTGTC
CGACCGCTTCCGCGTACCTCCACCTCACCTGCCCAAACCC
CACGTACTCATCCCTCCACCTTTAGGCCATCCCGGACACG
ACCCATACGGCCCACCTCCTTCTGCTCATGATGACCTAAG
ACCTCAAGGACAACCACCTGGAGACATGGGCCCATCCCGG
TCCCTCTCACAGGAGACCTTCCGAATCTCAACTGTCACCA
CTCGAAAACACAGCAACCTCATCACTGTTCCAATCCAAGA
TGATTCCGGCTCCGGACCATCCCGAGACCCGCTCTCTCAA
CCCGGAAATCCTCCCCCACCTCACCATCATCCTGGAGACT
ATACGGGTCAGCCTGTTGTGACCCATCCACACCACATGAT
GGCGCCACCTCAGCAGCATTACGGCCCGCCTCCACCTCCA
CCCATCAGTCACCCCATGCCACACCCGGGACAAGGCTCCA
ACACACCCCATATGGTCTTTAATCAAGCCCCTCCCCCTCT
ATCATCAGTCCCACCTCCGATAACCCCACCCCCCGGACAC
CTCATTGGTCAGATGCCACCATTTATGAACCATCCTCCAC
CCGGGCCACCCCCACAACATGGCGGACCCCCAGTTAATGC
CCCGCCACCCCATCATTACAACCCTCAGTTTGCAGAGGAC
AAGAGCACACTCAGCCCGCCATTCAATCAGCCGGGAGGTT
TGAGTCCTGGGATGTGGCCAGCCCCCAGAGGCCCCCCACC
ACGAATGCAGGGTCCCCCTCCGCAGGGACAGATGCCGGGG
CCCCATCACCCAGATCAGGGCAGATACAGACCGTATTACC
AGTAATAATGTGTATTTGATTTTTTTTTTCTTTGTTGTTG
CCGAATAAAGTGATTTAGTTTGTCAAGCTGGCAGGGATTC
AATTGCATATTTTATAGTCTGAAAACTATTAACTGTATAG
CAAAGATCAGTACTCACTGAATGGTGTTTTAAAAATCTTG
TCATCGTCAGATATTCAAACATTTACTTTTTAATAATCGA
GCCCATACATGCTGCATTTTTAGGGGCTTTTGTTGATTGT
TGAATGTGGTGTTTCTTGAATGTATTCACAATTAAATGTA
CAAATTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations