ZFIN ID: ZDB-TSCRIPT-090929-1447
Transcript Name: cdkn1ba-002
Previous Name: cdkn1bl-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009270 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009270|OTTDARG00000008137|ZDB-GENE-040812-3 cdkn1ba|no_translation cdkn1bl-002 LG_ BX649425.3 Danio rerio protein_coding NOVEL, 885 bp
GCGTCCGCGGAAAAGTGGAATTACGACTTCGCCGAAAACC
GACCGCTCGCGCCGGGCGACTACGAGTGGCAGGAGGTGGA
CGCCGACGAAGTGCCGGACTTTTACACCAGACCCCCTCGC
GTAAAACGGCCCTCTTCGGCCGGGACTGTGGATCATAACG
GGAACCACGATTATTTCTTGACGGCTCCCTCTCCGTCCCC
GGAGAGCGGAGCGGGGAACTCCGAACGCGCGGACGCCGGG
AACCGCTCGCTCAGCACGCCGAGGAAACGACCGTCGACGG
AAGATCAGGGTAAATGTTTCGCGGCTCGGACGTCTCTCCG
TTCGCGAAAGCGACCTTTTCTAACACCATCTACGTTCTCC
CAATAGATGATCTTCGCCGAAGCAAAAGACCCAGCGTCCA
CGCGAGCGAGGCCGACCCCTGTCCGGACGCGACGAGCTCG
CTCGAGCGCGCTCCCTGCGAACCGGACCCCAAAACGTAAA
GGAGATACGCCGAGAAGCCCGCCCTCACCATCGACTACTT
CGCCAGCCTTGCCAAGTAAACGGGGACAGACGGCGCTTCC
AAAATACAAATCGAGCCTCGGAGGGGCTGAATAAGCACTG
AATTTTTACACTAAACTTTTGGCACTCGACAGATTTTATA
TTTGCCTCAAAAGCAGACGATGTAGCAGTATGCGATTGGA
GTTGCTTCGTTTCTTCTTTTACTACCTATGTATATATATA
TATATATTTTTTTTCTTTTTATAATGTAGCACGTTTTCGT
TTCATGTTCATGTCAAAGCAAAACGCGATCCTTCACTAAT
CCACCGCGCTTCACTTTAAGAATTGCTGCGCGGTTTTTCA
AACGCATCTCCCGAACGAACCGTTTTAAAGTAGCCCACAT
ATCCC

cdkn1ba TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cdkn1ba-002 885
mRNA cdkn1ba-201 (1) 2280
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdkn1ba-002 Contained in:
OTHER cdkn1ba-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000009270 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI884002 (1) 567bp
    GenBank:BI882811 (1) 555bp
    CITATIONS (1)