Transcript

cbx3b-003

ID
ZDB-TSCRIPT-090929-14143
Name
cbx3b-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032978 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032978|OTTDARG00000025075|ZDB-GENE-070628-2 cbx3b|no_translation cbx3b-003 LG_ BX571678.14 Danio rerio protein_coding KNOWN, 466 bp
AGTTACAGTAGTGTAGAGTTTTATTACTCCAGAGCCTGTC
CAAAAGCTGCAGGTTTATTACTCTTGCCATGTGATTTATA
ATTCATCTCTCTTCTCAAGTTTTCTGAAGTTCATTTCTCT
GTGTGGAATCATGCAGGCTCACCAGCAGCCTCAGGAGGAG
CTCATTGAAAGGACTAATGAGGAGGTTGAAGAACACAACG
CTGAGATCCCAGTAGGCCAACCCGGCCACCCTGAGCCAGA
CTGCATCATCGGCTGCACAGACCAGCAAGGAGAGCTCATG
TTTCTTATCAAGTGGAAAAACACGGATGAGGTAGCTTTAC
TAGCAGCCGTGGAGGCCAGTAAAAGGTGGCCCCAGATGGT
AATCCGCTTTTACGAGGACAAGCTGACCTGGCATGGAGAC
GACGAGCAGTGAAAGAGAAAATATGTAGCAGTGGATACTA
CTGTACCTCCTGGCAGCTTTAAACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations