Transcript

cbx3b-202

ID
ZDB-TSCRIPT-090929-14142
Name
cbx3b-202
Previous Names
  • cbx3b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032977 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032977|OTTDARG00000025075|ZDB-GENE-070628-2 cbx3b|OTTDARP00000026671 cbx3b-002 LG_ BX571678.14 Danio rerio protein_coding KNOWN, 757 bp
AGCTACGTATTGTTGGCAGTGTTTATGAGAGGAATTCCTG
GAAACCATGAGGAAAAAACAGAATGTAAAAAACAGGAAAG
CAGAAGAGACGACAGTTGTTCAGGAGTTTGCAGTGGAAAA
AATAATTCGCAGAAGAGTCAACAACGGAAAGGTTGAATAT
TATCTGAAGTGGAAAGGATTTACAGATGCAGAGAATACCT
GGGAGCCAGAGGATAACCTGGATTGTCCTGAGCTGATAGA
AGAGTATCTCAGAAACCTAACTGTATTGGGACAGGAAACG
GAACAAGAGGAGTGTCAATCTCTAGATCACGAAGTTCAGC
CTAAGGAAGAGTTATCAGAGTTGGCTGCTGATATGGCTCA
CCAGCAGCCTCAGGAGGAGCTCATTGAAAGGACTAATGAG
GAGGTTGAAGAACACAACGCTGAGATCCCAGTAGGCCAAC
CCGGCCACCCTGAGCCAGACTGCATCATCGGCTGCACAGA
CCAGCAAGGAGAGCTCATGTTTCTTATCAAGTGGAAAAAC
ACGGATGAGGTAGCTTTACTAGCAGCCGTGGAGGCCAGTA
AAAGGTGGCCCCAGATGGTAATCCGCTTTTACGAGGACAA
GCTGACCTGGCATGGAGACGACGAGCAGTGAAAGAGAAAA
TATGTAGCAGTGGATACTACTGTACCTCCTGGCAGCTTTA
AACACACAAACACTGTGGCTTAAGTTTACTGTCCGTTTAC
TGTACCGTGTAATAAAGTGTGCAAAGCCACACTCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations