Transcript

spx-202

ID
ZDB-TSCRIPT-090929-1410
Name
spx-202
Previous Names
  • spexin-001
  • spx-001
  • si:dkey-13i19.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009156 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009156|OTTDARG00000008039|ZDB-GENE-041210-158 spx|OTTDARP00000007891 DKEY-13I19.7-001 LG_ BX649476.3 Danio rerio protein_coding NOVEL, 561 bp
GACACCCCAAGCTATGTTATATCTGAAAGGCACACAGGGA
CGGCGCTTTGTGTCAGAAGACAGAAATGAAGGGGACCTGT
ATGATACAATACGCTTAGAATCCCGCAGTCAAAACACAGA
AAACCTGAGCATCTCTAAAGCAGCGGCGTTTCTCCTGAAC
ATCCTCCAGCAGGCCAGAGATGAAGACGAGCCGTACTGAA
GAACATCAGCTCAACACCGCCAGCTTTCAGCTTCTCTAAT
GTGCCGTTATTTGTGTTTGTTTCATTCCACCGGGACTGAT
TATTTAAGGAATACAGCAGAGACTGATAGGGAGGTATTTC
TCGCTTCCTATGGATTCATTTCAGCTGATATAATGAGTTG
TTTTTATTCAAGACGTATCAACTTGGAAAAGAGATTATTT
ACGGCGAGTGCGATTCTGTGTAATATAAATGAACTGTACA
GTTTCTGTTTTTCTTCCTTTTGAGTTTCTCATGTTAAAAA
ATCGACACTTGATGCTCTGTAAAATACATATTTGAGAATG
TCTGAACATTTTCTCTATCAATTAAACTAAATTTGCACTG
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations