Transcript

brinp2-202

ID
ZDB-TSCRIPT-090929-14056
Name
brinp2-202
Previous Names
  • brinp2-001
  • fam5b-001
  • si:dkey-9e8.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032726 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032726|OTTDARG00000024946|ZDB-GENE-070912-621 brinp2|OTTDARP00000026482 DKEY-9E8.1-001 LG_ BX537141.17 Danio rerio protein_coding NOVEL, 2325 bp
ATGTGTTGGCAGAGAGCTGCGGTTGTTAGATGGTTCCTCT
TGATGCTCCTGTGGCACTGGGCACCTCTGGGCCCTCTGAG
CTGGTTTCTGGCTCTGGCTGAGCGTCTGGACCAGAAGACC
TCACCGTTCTCTTCCATCTCCGGCCGGAGCAGCGGCCAGC
TGGATTGGCTCCTGTCTGATAAAGGGCCCTTCCATCGCTG
TCCAGAATACACAGAGTTCAAAGAGCGCTTCCAACAAGGC
TTCTCCACACGCTACAAAATCTACAGGGAGTTTAGTCACT
GGAAAGTGAACAGCTTGGTGACAGAAAAGAGAGACTTCTT
CAAAGCCCCGCTGCCTTTGGCGCCAGAGTTTTTACGCAAC
CTCAGGCTTCTGGGGAGAAGGCCGAGTCTTCAGCAGATCC
ATGAGAATCTGATCAAGAAATATGGCACTCATTTCTTGGT
ATCAGCCACATTGGGAGGAGAGGAGTCACTCACAATTTTC
TTGGACAAACAAAAGCTGAGCAAAAAATCGGAGGGCAACG
GAAACAGCTCCGTGGTCTCACTAGAAATCTTGCACCAGTT
GGCGGCGTCGTACTTCACAGACAGAGAGAGCACCCTGAGA
AGACTGCACCACCTGCAGATCGCTACATCTGCCATCAAGG
TGACGGAGACCAGAACGGGGCCTCTTGGATGCAGTAACTA
CGACAGCCTGGATTCCGTCAGCTCCGTCTTAGTGCACAGC
CCCGAAAATAAGATCCATCTGAAAGGTCTTCAGGATGTGC
TTCCTGAGTTCCTGCGAAATCGTTTTGTGGAGGCGGCCCT
CAGTTATGTGGCGTGTAATTCGGAGGGCGAACTACTGTGC
CGTAACAATGACTGCTGGTGCCGCTGCTCCACAAAGTTCC
CTGATTGTAACTGCCCTTTTGCAGACATCAAAGCCATGGA
GGAGAGTCTGCGTAAGAGCAAAGAATCCTGGATCAACCTC
AACCAAGACTTCATAGAGTCAGATGAGTTCAAGGCCTTTC
TCAAGAAATTGCCAACGGATCATTTTTTAAACACCTCTGC
CGTCTTAAAGTTCTGGACGTCAGATCTGGTCCTGCAGAGA
CGTTATGGCCTGCTGGAGGCGAGCACTAAAGTGGTGCTGG
GAAAAGCCATCAAGATAGTGCGCAAACTCTTCGCTCTCAG
CAAGCGCTGTCCTACGCAGCCAAAAATCAGCCTGCCTAGA
GAAAGGACGCTGGGGTTTTGGCTCAACAAAGCTCAGTCTC
TGTTGTACTGCAGTGAGCATGGTGTGCACGGCACATTCTC
TGAGGATCTGCAGGGCTGCATCTGCGCCGCAGAGCAACGC
ACCGTCTGCCAGGGCACTGTGCCATGTAGGGTGGGTGAGG
GTACCCTCTGCTCCTCCTGCGCCCCGGACAACATCACCCG
CTGTGGCACATGCCTCCCAGGCAGCATCCTGCATATGGGC
TTCTGTCGACCCAATATTGCCAACTCTTTGGACCACTATG
TCAACTTTGACTTTGACATGCCAGACGCAGAGATGCGTTA
CCTTCTTCAAAGGCTTGACAGTCGCATGGAGGTCCACGCT
ATTTACATTAGCAATGATGTGCGTTTAGGCAGCTGGTTCA
ACCCGGCGTGGAGGAAGCGCATGCTGCTCACCCTCAAGAG
CAACAAGAACAAGTCCAACCTCATCCACATGCTGATGGGG
ATCTCTTTCCAGATCTGTTCCACCAAGAACAGCACCCTGG
AACCCGTGCCTGCAATCTATGTCAACCCCTTCGGGGGAAG
TCACTCCGAGAGCTGGTTTATGCCTGTCAACCAGCAGGAC
TTCCCGGACTGGGAAAGAACTAAATTGGACGCCTCGCTCC
AGTGCTATAACTGGACCCTCCCTCTTGGCAGCAAGTGGAA
GTCTTTCTTCGAAACGGTGCACATTTACCTGCGAAGTCGC
ATCATCACGGACGATCCCACGGTCAATGAGACGCTTTTTT
ATGAGCCGCTGGATTTGGATGATCACTCGGCTAACCTGGG
CTACATGAAAATCAACAGCCTGAAGGTGTTTGGCTACAGC
ATGCACTTTGATCCCGAGGGGATCAAGGACCTGATCCTGC
AGTTGGACTACCCGTACACGCAGGGCTCGCAGGATGCAGC
CTTCCTGATGCTTCTGGAGATGAGGGACCGCATCAACCGA
CTCTCTCCACCCGGGGCCCAGCCGCTGGACCTCTTCTCCT
GCCTCCTGAGGCACAGGCTCAAGCTTTCGTCCAGCGAGGT
GGTGCGCATACGGGAAGCGCTCCAGAGTTTTAATACCAAG
CTTCCCAACTCCAATGAGCCAGAACTCAGCCAGCTGTGCA
GCTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations