Transcript

prickle1b-203

ID
ZDB-TSCRIPT-090929-1310
Name
prickle1b-203
Previous Names
  • prickle1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008832 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008832|OTTDARG00000007782|ZDB-GENE-030131-2152 prickle1b|OTTDARP00000007618 prickle1b-001 LG_ AL929504.9 Danio rerio protein_coding KNOWN, 3389 bp
CTGGGATTCAAACTGGCTTTCTGCGTCTCCGCTATGCTGA
CCCATTGCTTCGCGATATTTGGATACTGAGCCCCTCCGCG
TCCTTTACAAAGACCGCTGGTTTACTTTCTGACAGCTGTA
CGGGAGCAAATGACACCAGTTGTGAATATTTTCTAACAGC
AACGGGAATAAAATACCTCACTTCGTCACCTGCCCCCATC
CCATGAGTCTTGAGACTACATCTGGGATCTGGCCCATTAC
TCGGGCACCGGACATGGACTCGAGAGGAGCCAAGGCATTT
GGGTTTCAGAGGAGTTCAACGTCTGATGACGACTCTGGAT
GTGCTCTTGAGGAGTACACATGGGTTCCTCCTGGACTACG
GGCTGAGCAGGTTCAGATCTACTTTTCGTGCCTACCAGAA
GAGAAGGTGCCATATGTCAACAGCCCTGGAGAGAAGCACA
GGATCAGACAACTACTCTATCAGCTGCCACCCCACGACAA
TGAGATTCGATACTGCCAGTCCCTCAGTGATGAAGAGAGA
CGAGAACTCCACATGTTCAGCATGCAAAGAAAGAAAGAGG
CACTTGGGAGGGGGACCCCAAAACTGCTTCCCAGAGCTCT
GCAACATAATTGTGAGCATTGTAAAGAGAACATCAACGGT
GGAGAGATGGCAGTGTTTGCTTCGAGAGCAGGCCCCGGCC
CTTGCTGGCACCCAGCATGCTTTACTTGCTACACCTGTCA
TGAACTTCTGGTGGACCTCATCTATTTCTACCACAATGGC
AATATCCACTGCGGCAGACATCATGCAGAGCTTCTGAAGC
CACGTTGCTCAGCATGTGATGAGATTATCTTTGCTGACGA
GTGTACCGAAGCTGAGGGTCGTCACTGGCACATGAAACAT
TTTTCATGCTTTGAGTGCGAGACTATTTTAGGAGGACAGA
GGTACATCATGAAAGATGGCCGACCCTTCTGTTGTGGATG
CTTTGAGTCATTGTATGCAGAGTACTGCGAGGCCTGTGGA
GAGAATATTGGAGTCGACCATGCTCAAATGACGTACGAGG
GTGTACATTGGCACGCTACTGACAAATGCTTTTGTTGTGC
ACAATGTAAAACCTCTCTGCTGGGCTGTCCCTTCCTTCCA
AAAGATGGTCGTATCTACTGCTCTAAGGACTGTAGCCTAG
GTGAGGATGTCCAGGCTTCTGATTCTTCAGACTCCGCTTT
TCAGTCCGCCAGATCACGGGAATCTCGACGCAGTATTCGA
ATGGGCAAGAGTAGTCGCCCCACAGAACAGTGCCAGCAGA
CAAAATTGTACTCAGCAACAGATTACAGGACCTCTAGTCT
ATGTGGCGACAACACAGAGACAATGTGTCATCAGCTGGAG
AGAATCAACTTTACAGAAGACAACTACTGGAGAGAGCGAG
ATGAGCAGGAAGCCCCTGAGGACTCTGTGGAAGATTGGGC
TGAGCATGAGGACTACATGACTCAGCTGCTCCTGAAATTT
GGAGACCGTGGTGTCATCCACGCAGAGGACAGCAGGGCAG
CAGAGCCATGGATGGTGAAAGACACCGAAACCAACCGAAC
CAAACCAGAGATAAAGATGAGCGGCCACAATTTGGCAAGT
AAAAAGCACCACACTGACATGTATTGGGCCCAGTCTCAGG
ATGGACTTGGAGACTCTGCTTATGGTAGTCACCCTGGACC
AGCTAGCGCTAGAAAGATTCAAGAGCTGGAGATGGATCAG
GGAACAGTACCTGGATTTTGGTCTGAGCCAAGGCAATGGT
ATGAAGACTCATTAGAGTGCATTACAAGTGAACTCCGGAA
GGCAGACCACAATATTGGAGATTCTATGGATTCTCTGGCT
CTCTCAAATATTACAGGAGCTTCAGTGGATGGGGACAGCA
AGGACAGACAGACCATTTACTCCCTCCAAAACATGAAAGA
CCAAGAAAGAGAGATAGAAGAGTGTGATAACATTAGTAAC
GTAGGCACACTAAACTCCTCAATGCTCCACAGAAGTGCTA
ATTCCCTGAGGAGTTTAAACTCCGAGCTAGGTCATGAGGA
GACACTGGGGCAGGGAGCAAGAGAAGACGATGAAGAGGAC
AGAATACCACCATATTTTGGAGCAGAACCACCATCTCCTC
TGAATCTTCCAGTGCTGAGAAGGACCAAGTCACAATCTCA
GCCGCAATCCAGATCTCAGCAAGTAAAGTTCTCTGATGAT
GTTCTGGAGAAAGGGTATTATGGTGCACTGGGCTTAAGGC
AACCACCAATGAGTGAGAGGACACGCAGGAGGACCTTTCA
CATAGAGGAGGAGGCAGCGGCAGCAGCAGAGAGACGTCCT
GCTAACAGACATCACCACAAACGCAGGCACAGTCGGAAAA
CGCGTTCAGAAAATGCATTGCACCTGCCTTCCAAAAATCG
TGGGAAACTGCATGTTGTGCCTCAGGTAATCAGCTCAAAC
ATGCCAGAGCCCAGGAATGGTATTCTACTAAATCACTCGG
CGCACAGTCAGCACCCTTATCGTCAAACCACCTCAGACTT
TCCTCAGCAAGGTATGGTCCGACTGGACCAATTCCAGGAC
TTTTGTGATGATGACGAAGAAGATGATTGGTGTTCAACAT
GCTCTTCTTCATCTTCAGAATCTGAGGAGGAGGGATTCTT
TCTAGGTCAGCCAATCCCTAAGCCCCGATCCCAAAGTTTT
CATTATTACACAGAGGACTATCCGACTCGGGTCACGGCTT
TAACGCCTCCTTTTGGCTCAAGGACCAAACTGAAAAAGAA
AGGTCACAAGGGCAAGAACTGCATAATTTCTTAGACTGAA
GATTGCCTCTGTTTCAGCTGGAATATACTCATGCCTGATC
CTACAGAAGATGGAAAGTTCTCTTTACAAACACTGAGAGC
CAATTACGTTGCTGTTGTACAAACAAAGAAAGTAACATGT
AAGATTTCCTTGTACATTGTATAGCAAAAGCATTATTCCC
AAAAGCGAAATAAAAGTAGCATGTAGACTAACTAAATAAT
TATTTAATAGTGCAAGCGATGTATATTTGTTAAATTAAGA
TTGGAATACTGATATTTTTATATCCAATTATGTTAAATGA
GTAATTACCACAATTTACTGACCTGATGGAGTTTTTATGA
TTATTAAATGAACTAATTGAGGTTTGCTGACCAGGGATTT
GCAAATGCAAAATATATATGCACTATTCATGCGTGATGCC
CTCGTTATGTTATTCTACAAGGTGTAATAAGTGCACCCTT
TAAGATTTCTCTGTCCATAATGTGTTTATGCGCTTAAACA
ATGTTAGGGGAATCTTTCCTCTAGTATATACACAATACAC
CACAGGTAACCATGCTATCCTTTTTATCGTTGAGATGTCA
ATAAAATATTTCAAGAGAGATTTAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations