Transcript

dlx4a-201

ID
ZDB-TSCRIPT-090929-13
Name
dlx4a-201
Previous Names
  • dlx4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001708 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001708|OTTDARG00000001595|ZDB-GENE-980526-73 dlx4a|OTTDARP00000001498 dlx4a-001 LG_none CR387987.6,AL590145.3 Danio rerio protein_coding KNOWN, 1195 bp
CGACGCTGTTGAGATGAAGTTCTCAGACTTCACACACGGC
CAAAACGAAAGCAAACGCACCAGCCCCACGGACATGGATC
TCTTTGATGGCCCTCTTTAAGAGATGGAAATTACATGACT
TCTAAATAGATGCCACTTTTATGGTGCACCGGTCTAATGG
ACATAACTCTAAAACATGACTATGACTTCATTGTCTGAAA
GTTTGGAGGCTTCAGATCCCTCAAAGTCGGCTTTTCTGGA
GTTCAGTCACGGTTACCAGTCTCACCAGCAGCATTCACCC
GGTGTGTCTCACGCGCACTATCCGGTGCACGGTTTGCATC
AAGGCGCGCATTCGCAATACGACGCGGCCTTCTCTCCTGG
CGCTGCGTCTTACAGCCGTCCACTCGCTTACCACTATTCC
ACCGCACACCACCATCCAGGAGCTTACCTACCCTATCAAC
ACAACAGCGCAGTCGGATATTCAAGAGTTGAGGATGCAGA
TTCCGAGAAGCAAAGTTCCATTGAAAGTGGAGAAATACGG
CTGAACGGGAAGGGGAAGAAGATTCGCAAACCGCGCACGA
TTTACTCGAGCTTACAGCTGCAGGCGCTCAACCAGCGCTT
CCAGCAAACCCAGTACCTCGCGCTGCCCGAACGCGCTGAT
CTGGCGGCTAAACTGGGTCTGACACAAACACAGGTCAAGA
TATGGTTCCAGAACAAGCGTTCCAAGTACAAAAAGATCAT
GAAACATGGCTCAAGTGGACCTGAAGGAGAACACCTTCAA
GCAGCGTCTGCTTCAGGAGCCCCATGTTCACCAGGCATGC
CACCCCTATGGGATGTTTCCATGCCCAGCAAAGGTGCTCC
CATCCACTCTGGAGGATATATGAACTCTTTCGGACACTGG
TACTCGGGTCATCATCAAGACCCAATGGCCAGAACTCAGA
TGATGTGATGGGACGTTTAGAACAATCTACAGTGTTTCCA
CGTCCCATCTACTGATTCCAGCAGTTCACACCAGCACTCT
TTAGCACTGCGTACTCCGCCAAACATCCTTCCCAGTATTT
TCCTCATAAAGATTTACATTGCTGACATTTTGGTTTATTT
GCTTGCAGGTTTTTGTGGTGGATTTAAAAAAAAAAGACTG
AATAAACAGCCTAACCTGAACTTGGATTTTTGTATGTTCT
TGTAAATTTGAATAAAATGCCTTTGTCTGATTGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations