Transcript

wnt5b-201

ID
ZDB-TSCRIPT-090929-12909
Name
wnt5b-201
Previous Names
  • wnt5b-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030803 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030803|OTTDARG00000023607|ZDB-GENE-980526-87 wnt5b|OTTDARP00000048609 wnt5b-003 LG_none BX649324.3,BX842699.5 Danio rerio protein_coding KNOWN, 2049 bp
TGACGCCGTCATACACTGAAGCGCGGTACGTTTATCAAAA
CTTTCAACCGTTTTCACCGAGTGACTTTCGCGGAGCCTTT
TTTATTCTCACTATGGACAGCGCCGGACTGTTTTGGAGTA
TGTCTTTGGTTTTCTAAGTGAATGAAACACTGGAAACTCT
AGTGCCAAGTTAAATTGTTCGGAGGTGGAATTGTCTAATA
TTTTCTGAAGTTACTCCTACTTTGTATGCGCTTCACAAGA
ACATCACGCAGAGCCAGAAGACCAGGTTCAGCTGTCAGGA
CTTCAGCTCTGGAACTTTTTTGGAGACGGATAGATCGACA
TCTGCTAACAAGTGTGCAAAGCCATCTTTCCCTGAAGTCT
TTCCTATTGACGGACAAGCTGTTCAACCAATAAAGCACAG
GTTTTTGCTCGGGATACATCTTTCTTCCATTTCGACAATC
AACTTTGATCCAACTTCCAAGAACTTCCATCTGAGGAGGC
GCTTTGCATTTCAATTTCTTGGAGGAGGAAGGATGGATGT
GAGAATGAACCAAGGACACCTACTTCTGGCAGTGACCCTC
ATCGTCTGCAACTCACAGCTGCTGGTGGTCGCCAACTCGT
GGTGGTCATTAGCCATGAACCCCATCCAGAGACCGGAGAT
GTACATCATTGGAGCACAGCCTCTGTGCAGCCAGCTGACG
GGCCTATCTCAGGGTCAGAGGAAGCTCTGCCAGCTCTATC
AGGACCACATGGTTTATATTGGAGAGGGGGCGAAGACGGG
CATCAAAGAGTGCCAGTATCAGTTCAGACAGAGGCGATGG
AACTGCAGTACAGTGGACAACACGTCAGTGTTCGGCCGTG
TCATGCATATAGGCAGCCGAGAAACAGCTTTTACATACGC
CGTCAGCGCAGCGGGTGTTGTGAATGCTGTGAGTCGAGCG
TGCCGTGAGGGTGAGCTTTCCACCTGCGGCTGCAGTCGAG
CGGCTCGTCCCAGAGACCTGCCCAGAGACTGGCTGTGGGG
CGGCTGCGGGGACAACGTCAACTATGGCTACCGCTTCGCC
CGGGAGTTTGTGGACGCTCGTGAACGTGAGAAGAACTACC
CACGCGGATCGGTGGAACACGCACGCACGCTTATGAATCT
GCAGAACAATGAAGCCGGAAGAATGGCGGTGTATAATCTA
GCGAATGTGGCCTGCAAGTGTCATGGCGTCTCAGGCTCGT
GCAGCTTGAAAACCTGCTGGCTCCAGCTGGCCGACTTCCG
GCGTGTTGGAGAATTCCTGAAGGAGAAATACGACAGCGCC
GCCGCCATGCGCATTAACCGACGTGGAAAACTAGAGCTGG
TCAATAATCGATTCAACCCACCGACAGGTGAAGATCTGGT
CTACATCGACCCCAGCCCGGATTACTGCCTGCGCAATGAA
ACCACTGGGTCTCTGGGCACCCAAGGCCGCCTATGCAACA
AGACCTCGGAGGGTATGGACGGCTGCGAGCTCATGTGCTG
CGGCCGCGGGTACGACCAGTTCAAGACCTACAAACATGAG
CGCTGCCACTGCAAGTTCCACTGGTGCTGCTATGTCAAGT
GCAAACGCTGCACGTCACTCGTAGACCAGTTTGTGTGCAA
GTAGCAGACGTGAGAACTGGGGGACAGACGCACTGAGCAA
TTAAGCAGGAGAAGAAACGGGACCCTTAACGGACCCAGAG
GGGCAACTTAGAGATAATTAAATGTAAAAATGATATATTA
AATAGCAACAAATTAAAATAAGTATATAAATAAGTGTACG
TGTGCCGTTGATAGTAATTTAATGACCTGAGGATCCACGT
TGGACGTCATTGATGAAAAAGGAGGCACCGGTGTGATGCA
TTCCGGCTCAAGCTGTGTTTCTCTCATAAAGAGAGGAAGG
AACTCTTGACTTGTGCTACAAGAAACTCTTTAGAGACTCG
AGGAAAAGGCGCAGAAATAGGATGGGGAACATCAAGGGCG
CATCACCCACCCATTGCCTTCCAATTCATAAACACACACA
CACACTCCACCTTGCTGATGTCAGAGCTCTTAAGAACTTT
CGGAATGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations