header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12705
Transcript Name: irf8-201
Previous Name: irf8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030509 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030509|OTTDARG00000023424|ZDB-GENE-040718-367 irf8|OTTDARP00000024854 DKEYP-77B5.1-001 LG_ BX890541.5 Danio rerio protein_coding KNOWN, 1767 bp
TATAAATAAAGCTGCTTGGATGCCGTGAGTATGTACTTTA
TAATCCTCAGCTGCTGTTTGTAACGGCATACTAGTGAAGT
AAAGGTCTACAAGATGAACTCGGGCGGTCGCAGACTGAAA
CAGTGGCTTATAGAACAGATAAACAGTAACATCTATAATG
GACTGCAGTGGGAGGATGAGGACCGCACTATGTTTCGAAT
CCCCTGGAAACATGCGGGAAAACAAGATTACAATCAAGAG
GTGGATGCGTCCATTTTCAAAGCGTGGGCAATATTTAAAG
GGAAGTTTAAGGAGGGGGATAAAGCTGAACCAGCGACATG
GAAGACCAGATTGCGCTGTGCACTCAACAAAAGCCCAGAT
TTTGAGGAAGTTACTGACCGATCCCAGCTTGACATTTCTG
AGCCCTACAAAGTGTACCGGATTGTGCCAGAGGAGGAACA
AAAGTTAGGTAAAGGCACAGTCACCACCGTAAAAGACACC
ACTGACATGGACTGCTCACCAGACTTGGATGAAATTATTA
AAGAGTCTTCAAATGATGAATACATGGGCATCTTGAGAAG
TAGTCATTCTCCCCTGGATGAACGCAGTAGCATGCCTTCA
GTGCAAGAATGGTGGCAGCAAGGACCTCTCAATGCTGCTG
TTGTTCATCAGGATCCTGCAGGCTCATTAAATTCTGCATT
CTCTCAGATGTTGATTTCTTTCTACTACGGAGGTCAGATG
GTGGACAACATGGTGACCACTCATCCAGAGGGCTGCCGTA
TCTCCCCCTGCCTGCCCTCTACGGCTAATGGCTTCTTGTA
CGGGTCAGACAGCCTCCAGAACATTTACTTCCCATCCATT
GACGGCATTAAGAATGAGCGCCAGCGTCACGTCACCCGCA
AACTTTTCAGTCACTTGGAGCGCGGCGTACTGCTGCGTGC
CAACAGAGAGGGCATTTTTATCAAGCGTCTGTGCCAGAGC
AGAGTGTTCTGGATTGGCCAGGATGCTCGGTACAACCCCT
GCAAACTAGAGCGAGATGCTGTGGTGAAGATCTTCGATAC
AGCCAGATTCCTACAAGCACTGCAGTTGTATCAGGATGGT
CATTATCAGGCTCCAGAGCCCACTGTCACACTCTGCTTCG
GGGAAGAGTTTAACGATTTCAGCACTGTCAAGAGCAAATT
AATCATTGTGGAGATCACAGCATGGAACTGTCAGCAGCTT
TTGAATGCAGTGACTGCACGGCGAACCCAGTGCAGTAGTG
GGAATATGGAAATCTCAGACAACTTAGTCAGTGATCAGAT
GGCTTGTATATATCAGGACCTGTGCAGCTACCCAGTTCCT
CCACGAGCTTCCTGTTTCAGGGACAACTTACAGATACCAG
TCTGAGGCAGAACTGCCATGTTTTCAAGATTGAGTCAGTT
CACATGCTGAGCCAAAATTATGCTTTTACATCAATATCTC
ACACAGAAAAAGAATCGACCATTAGGCTTCATGTGTGTTA
CAGTTCTCTCAGGACAGAAGAATCATTTTCTCAGGGATGA
TATGCATGTATTTTATCTTTGTGTATATGTTGTTTACATT
TTTTACTCATTGATCATTCATCTTAAACATTTGAGATTCT
GTAGTTTTTTAGTATGGACTATGAAGTTGATAGGTTTTAC
TATCCATAATTGTTTTAAATCTTTTTTAACCCAATAATTG
TTTTGTTTTTTTTAACTTGAATGTAATTCTGAGTGTAATT
CTGGAAATATATTTTCAATAAAAAATCTATGATTAAATAA
AATGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
irf8-201 Contained in:
[BAC] DKEYP-77B5 (1)
OTHER irf8-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030509 (1)
  • Ensembl_Trans:ENSDART00000078894 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC075963 (1) 1738bp
    GenBank:EB916164 (1) 517bp
    CITATIONS (2)