Transcript

sema4ba-202

ID
ZDB-TSCRIPT-090929-12701
Name
sema4ba-202
Previous Names
  • sema4ba-001
  • si:ch211-138h3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030503 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030503|OTTDARG00000023420|ZDB-GENE-070705-31 sema4ba|OTTDARP00000024851 CH211-138H3.1-001 LG_none CT573123.7,CR853284.6,CT573286.9 Danio rerio protein_coding NOVEL, 2912 bp
CAGATACACACAGTCACAGCAGCACACAGAGCACGAGCGT
GAGCTTCGTACTACCAACCTCACATTCAGACCAACATACA
GCTGATACTGGCCGTCTCATAAGCTGGATCTATTGACAGA
ACTCTGATTTCCTTTGGGATTCCCTTCTGCTTTCCCCCCC
ATGAGGAACCAGCTGAAAATCTATCCTAAAAAGAATTGCT
GAACACAACACATTGTGGGAGTCTCATGGAGACTGATTTG
TGCTGTACCGCTGTCCTTGAGGACTCAATTCTTGGTAGAA
ATCCACCATTGTGAGGCCCTGTGAAGGTGACCCCAAATCC
TCAACACACAGCCCTGCTTTTCAGGAGCTTGAGGAGTAGA
AGAAAAAGAAACTGTAAAAAAAAGATCTTCATGAGAGCCC
GAAAATCTAGAGTCACAAAATGTGGACACTAAACATGACA
CGTGTCTTTTTCCTGTTCCTCCTCAACGTCCTCCTGGTCG
GACGGTGTCAATCAGCAGAAGACGACGTCACCCCTCGCCT
CAGCTTCTCTTACAATGCAAACGAGAGGTCGGCCAAGAGA
TTTTCACCCAGTGGAGTCTTCAATTACACCTCTCTGCTCC
TCAGTAAAGAGGATAACATGCTGTACGTCGGCGCTCGAGA
GACTCTCTTCGCACTTAATATCAGCGATATCAGCAGAACG
CAGATGCAGCGCAACTTAACGTGGAGCACGCCGCAGAGAA
AAAGAGATGAATGCAGTTTCAAAGGGAAGGACTTAAAGAC
GGACTGCTTCAATTACATCAAGATTTTACTGCGTGTGAAC
AGCACTCATCTGTACGTGTGTGGAACGTATGCCTTCAGTC
CAATCTGCACATACATCGTAAGTACTAACACATCAAACTT
TTCCCTGGTGCGCAATGAAGTGGGAGAAATAATGACTGAA
GATGGTCGAAGCCGATGCCCCTATAACCCTGAATACAAGT
CCACGGCCATCATGGCTGATGGAGAACTGTATGCTGGCAC
TGTCAGTAATTTCCAAGGAAACGATCCCATCATTTACAAA
AGTCTTGGCCAGGGCACAGCACTAAAGACTGAAAACTCAC
TGAACTGGCTTCAAGACCCCGCTTTTGTGGGCTCAGCCTA
CATTCAGGAGAGTTTGCCCAAAGGCAATGCAGTGGGCGAT
GATGATAAGATTTACTTCTTCTTCAGTGAAGCAGGAAAGG
AGTTCGATTTCTTTGACAACACTATTGTGTCACGCATCGC
TCGCGTGTGTAAGGGTGATAAAGGTGGAGAGAGGGTTCTT
CAGAAGAAATGGACGACCTTTCTGAAAGCCCAACTCCTGT
GTTCACTGCCTGACGATGGCTTCCCCTTCAACATCATCCA
AGACATGTTTGTACTGACGCCCAGCAAAGAAGACTGGAAG
AAAACCATGTTTTATGGAGTCTTCACCTCACAGTGGTACA
AAGGTGCTTCAGGGAGCTCAGCTGTATGTGCTTTCACTAT
GGACCAAGTTGAAGAGGCGTTTAATGGACGTTACCGGGAA
GTTAATCGCGAGACGCAGCAGTGGTACACCTACAACCATC
CAGTGCCAGAACCCAGACCTGGAGCCTGCATCACTAACAC
GGCCCGCGCCCAGGGGATCTCCTCTTCCCTGCACATGCCT
GATAGAGTCCTGAACTTTGTGAAAGACCACTTCCTCATGG
ATAATGTGATTCGCAGTCAGCCTCTGCTGTTGAAACGAAA
TGTGCGCTACACGCAGCTCGCTGTGCACAGAGTACAGGCT
CTCCACAAGACCTATGATGTGCTTTTCATTGGCACAGATG
ACGGCAGAATCCACAAAGCCATCAACGTTAAAAACAAGAT
GTATATCATTGAAGAGCTGGTGATTTTTCCTGAGCCTCAA
TCCGTGCAGCACATCGAACTGGATGATGAGAAGGGACTGT
TGTTTGTGTCCAGCTATTCTGGGCTGGTGGAAATCCCTCT
TGCCAACTGCTCTAACTACCAGAGCTGTGGAGAGTGTGTG
CTGTCTAGAGACCCATACTGCGCCTGGACAGGGAAGCAGT
GTTCTAATGTCAAGCATGCGTCCTCTAAGAGTCAATGGCA
ACAAGATGTAGAAGATGCCAACACTGCCATTTGCAAAATG
CCCAGTCCCCGTTCAGGAAGACCACGTGTTCCAGCATGCC
ATGTGGTAGAAATCCCAGCAAACACATTTACAGTTCTACC
CTGCAAACTGCGATCCAATTTAGCTGCAAGACGATGGGAG
TACAGTGATACCGCAGAGCGTTTTGTCTACCCAAGTCCTG
ATGGCGGCCTGGTGGTTGTAGCCCAAGTGGACAGGCAGGA
AAACTACGCGTGTTGGTCCGAAGAAGGCAACTATCGGCAA
CTTCTGGCCAGTTACTGTGTTAAAGCGGAGCACGAAAGCA
CCACCCTGACTGGACGTTCCCGAACACAGCAGGTGACCCA
AGGAGAGACTATTCTACCTGGCGAAACGTGGTCACCACAA
AAAACCAAAACATACTGGAATGAGCTGATTGTTGTGTGTG
CCTTACTCGTGTTCTCCCTAGTAGTACTGTCGCTTTTTGT
GGCGTACAGGAATCGAGATAGGATGAAGTCCATGTTAAAG
GAAGGCGAGTGTCCTAACATGCAACAGAAGAAGCCGCGAA
TTCCAGGGAAGCACACTGAAAGCCTTCCGTTAAATGGCAA
CAACATCCCGCCCTCAGTGTCCGACCACAAGGGCTACCAG
ACTCTTAATGACAACTACATCTGCAGCACTCCAACCCACG
AATGTTCCTCTCCCGAAAACAGCAAGAGCTTCTCAGAGTC
TGAAAAGAGACTGTTGACTGTTAACTTAAAGGAGAGCCAT
GTGGAGATCTCACCCACTTGCCCGCGGCCTCGGGTACGAC
TAGGCTCGGAGATTAAAGACTCCATTGTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations