Transcript

map2k1-201

ID
ZDB-TSCRIPT-090929-12648
Name
map2k1-201
Previous Names
  • map2k1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030444 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030444|OTTDARG00000023382|ZDB-GENE-040426-2759 map2k1|OTTDARP00000024805 map2k1-001 LG_ CT863714.10 Danio rerio protein_coding KNOWN, 2093 bp
AATCTCAGCACCCATCCTCTGCTGTCGCACACCCATAGAA
ATACTCTAAATAAGCTATTTTTCGAAACAACCACTATCGT
ACCCGCAAGAAGACCATGCGAGACTGTCGTTAGCTGCATT
CTGTGTTTATTTATTTATTTATTGTAAAGCAAACAGCCAT
TGGTAGGGTGTGATAGGCTATTCATAGCTTATGCATCACT
GCTCTGTCGGCGGGTGAGTTGGTGTAGTCTGCGGATCAGA
TTGCTTCTGTTTGAGTCTTTTTTTTCGTCTGCTGCCGAGA
AGCCAGCTATTAGGATTCATCATGCAGAAAAGGAGGAAGC
CAGAGCCGATCCAACTGAACCCAATTCCAGATGGGAACGC
TATCAACGGCACCGGGGCCACAGAAACAAATCTGGAAGCT
CTGCAGAAGAAGCTGGAGGAACTGGAGCTGGACGAGCAGC
AGAAAAAACGCCTGGAAGCTTTCCTCACCCAAAAGCAGAA
GGTCGGAGAGTTAAAAGACGATGACTTCGAGAAGATCAGC
GAGTTGGGAGCAGGCAATGGAGGAGTTGTGTTTAAAGTCT
TACACAGGCCGTCAGGCTTCATCATGGCCAGGAAGTTGAT
CCACCTTGAGATTAAGCCAGCAATAAGGAATCAGATCATC
AGAGAGCTGCAGGTGCTGCATGAATGTAACTCTCCCTACA
TCGTGGGCTTCTATGGGGCTTTCTACAGCGACGGAGAGAT
CAGCATCTGTATGGAGAACATGGATGGCGGCTCTTTGGAC
CAGTGCCTTAAGAAAGCAGGCAAGATCCCAGAACAAATAC
TGGGCAAAGTTAGCATTGCGGTGATTAAAGGTCTGTCATA
CCTGCGGGAGAAACACAAGATCATGCACAGAGATGTAAAG
CCATCTAACATCTTGGTCAACTCGCGTGGGGAGATCAAGT
TGTGTGACTTTGGTGTGAGTGGACAACTCATTGACTCCAT
GGCCAATTCCTTCGTGGGAACCAGGTCCTACATGTCTCCC
GAACGCCTTCAAGGCACTCACTACTCTGTCCAGTCTGACA
TATGGAGCATGGGTCTCTCTCTGGTGGAGATGGCCATCGG
ACGCTTCCCGATCCCACCACCTGATGCCAAAGAGCTGGAA
CAAATCTTCGGTCAGCCCCTGGAGGGAGACCCATCAGCCA
GTGACACTTCTCCAAAACCCAGGCCCCCTGGTCGACCTGG
CAGCTCATACGGTCCAGACAGCAGACCTCCCATGGCTATA
TTTGAGCTACTTGATTATATTGTCAATGAACCACCTCCAA
AGCTACCAAGTATCTTTGGTGCAGAATTTCAAGACTTTGT
AAACAAATGTTTAATCAAAAATCCAGCAGAAAGAGCAGAC
CTCAAGCAGCTGATGGTTCATTCGTTTATCAAGAACTCAG
AGGCTGAGGAGGTTGACTTCGCTGGATGGTTGTGCAGCAC
CATTGGACTGAACCAGCCAGCAACTCCGACTCACAGTGTG
GGAATGTGAAAACAGCCATATTTTTCTAAGCCAACTGTTG
GTGTTTCTTCACCCTCAAAATCTTCAGTTCCACCCAGAGG
TCAACAGCAAACTACTGCCTCCTGAATCCACCCAGTCTTA
TTTTAGGTGTTGTCTAAGTATTAACAAACACACTGCTGTA
ATTAACAAAACATCACATCACAGTGCACTCAAAACCTGTT
CTACAACATATCGGTTGGTTTATGCTAGGATGGCATCTGT
GAGAGATGACAAATACCTATTTTTTCCTTACACCAAAATC
TCAATTGCAAAAGCTATCAAATGGCAGACGTTACACCGCG
CAAATGCAAAAGACCTCCCTTCTAAATGTCCACTTGTGAT
TGATATACTTTTTAAACTTAAAGATTTATGATTGAAGTCT
TTGACCCCAGAGATGCTTACGTGGTTTTATTGTAATGTTG
TGTTCTGCTTTCAGTATGGTGAATTTGCAGCCTTTAATTC
AAAGAGAGTGAAAAATCAGTCATTTAACTTATACAAATGT
GTATACTATGATAGGATTTATTTAACAGATGGCAACCAAT
GGAACGTGGCAATGCTTATATTGTATGCAGTGAATTAAAA
TGGACAGATTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations