Transcript

myhz1.1-201

ID
ZDB-TSCRIPT-090929-12632
Name
myhz1.1-201
Previous Names
  • myhz1.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030413 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030413|OTTDARG00000034824|ZDB-GENE-000322-5 myhz1.1|OTTDARP00000024784 myhz1.1-001 LG_ BX510649.12 Danio rerio protein_coding KNOWN, 6006 bp
ACAGTATAAAGAGCTTGAGCTGGACTGGAGATCTCTGCGT
TCAGAAGATCAGCCAGGCTTGATTGTGTGTTGCAGAATTT
CATCAGAAACTGTGGGAGTGTGGTCAGAAGTAAGCCGCCA
TCATGAGTACTGACGCGGAGATGGCCGTTTATGGCAAGGC
TGCCATTTACCTCCGTAAGCCTGAGAAGGAGAGAGTTGAG
GCTCAGAACAAACCCTTTGATGCCAAAACCGCTTGTTATG
TGGTTGATGACAAAGAGCTGTACGTCAAGGGAACAATCAA
GAGCAAAGATGGTGGCAAAGTCACTGTTATTACCCTTGAC
ACTAAGGAGGAGAAAGTTGTTAAGGAGGATGATGTCCACC
CAATGAATCCTCCCAAGTTTGACAAGATTGAGGACATGGC
CATGATGACCCATCTCAATGAACCCTCTGTGCTGTATAAC
CTCAAAGAGCGTTATGCAGCATGGATGATCTACACCTACT
CTGGGCTGTTCTGCGCCACTGTGAACCCCTACAAGTGGCT
CCCAGTGTATGACGCAGAAGTGGTTGCTGCCTACAGAGGC
AAGAAGCGTATGGAGGCTCCACCCCACATCTTCTCTGTCT
CTGACAACGCCTATCAGTTCATGTTGACTGACAGAGAGAA
CCAGTCTGTCCTGATTACTGGAGAATCTGGTGCTGGAAAG
ACTGTGAACACCAAACGTGTCATCCAGTACTTTGCCACTG
TTGCAGTTCAGGGCCCTGAAAAGAAGAAAGAGCAAGCTTC
TGGCAAAATGCAGGGCTCTCTTGAGGATCAGATCATTGCT
GCCAACCCTCTGCTTGAGGCTTATGGTAATGCCAAGACTG
TGAGAAATGACAACTCCTCTCGTTTTGGTAAATTCATCAG
AATTCATTTCGGCACGTCTGGAAAACTGGCTAGTGCTGAC
ATTGAGACATATCTGCTGGAGAAATCTAGAGTGACATTCC
AGCTTCCAGATGAGAGAGGCTACCACATCTTCTACCAGAT
GATGACCAACCACAAGCCTGAGCTGATTGAAATGACGCTC
ATCACCACCAACCCCTATGACTTCCCTATGTGCAGTCAGG
GTCAGATCACAGTGGCAAGCATTGATGATAAAGAGGAGCT
GGTTGCTACTGATACTGCTATTGACATTCTGGGCTTCAAT
AATGAAGAGAAAATGGGCATCTACAAGTTCACTGGAGCTG
TGCTTCATCATGGTAACATGAAGTTCAAGCAGAAGCAGCG
TGAGGAGCAGGCAGAGCCTGACGGCACAGAGGAGGCTGAC
AAAATTGGTTACCTTCTGGGTTTGAACTCTGCTGATATGC
TGAAGGCTTTGTGCTACCCCAGAGTCAAGGTCGGAAATGA
GTTTGTGACCAAAGGACAGACTGTACCACAGGTGTACAAC
TCTGTTAGCGCCTTGTCCAAATCTATCTATGAGAGGATGT
TCTTGTGGATGGTCGTTCGTATCAACCAGATGTTGGACAC
AAAACAACAAAGAAATTTCTTCATTGGTGTGCTGGATATT
GCTGGTTTTGAGATCTTTGATTTCAACAGCATGGAGCAGC
TGTGCATCAACTTCACTAATGAGAAACTGCAACAGTTTTT
CAACCACCACATGTTTGTGCTGGAACAAGAGGAGTACAAG
AAGGAGGGCATTGTTTGGGAGTTCATTGACTTCGGCATGG
ACTTGGCCGCTTGCATTGAGCTCATTGAGAAGCCCTTAGG
TATCTTCTCCATCCTTGAAGAGGAGTGCATGTTCCCCAAG
GCTACAGACACTTCCTTCAAGAACAAGCTGTATGATCAGC
ATCTTGGCAAGTGCAATGCTTTCCAGAAACCAAAGCCTGC
CAAAGGCAAGGCTGAGGCCCACTTCTCCCTGGTCCACTAT
GCTGGAACTGTGGACTACAACATTTCTGGCTGGCTGGACA
AGAACAAGGATCCACTGAACGAGTCTGTTGTGCAGCTTTA
CCAGAAGTCTTCAGTCAAACTGCTGGCTACTCTCTACCCA
CCTGTTGTTGAGGAGACTGGCGGCGGAAAGAAGGGAGGAA
AGAAGAAGGGTGGTTCCATGCAGACTGTGTCTTCCCAGTT
CAGGGAGAACTTGGGCAAGCTCATGACCAACTTGAGGAGC
ACTCACCCTCACTTTGTGCGTTGTCTGATTCCCAATGAGT
CCAAGACTCCAGGTCTTATGGAGAACTTCCTGGTTATCCA
CCAGCTGAGGTGTAACGGTGTACTGGAGGGTATCAGAATC
TGCAGAAAGGGTTTCCCCAGCAGAATCCTCTATGCTGACT
TCAAGCAGAGATACAAGGTGCTGAATGCCAGTGTTATCCC
AGAAGGACAGTTCATTGACAACAAGAAGGCCAGCGAGAAA
CTCCTGGGATCTATTGATGTTAATCATGACGAGTACAGAT
TTGGACACACAAAGGTGTTCTTCAAAGCTGGTCTTCTGGG
TACTCTTGAGGAGATGCGTGATGAGAAACTGGCTAGTCTG
GTCACAATGACTCAGGCTCTCTGCCGTGCTTACCTGATGA
GGAGAGAGTTTGTAAAGATGATGGAGAGGAGAGATGCAAT
TTACACCATCCAGTACAATGTCCGCTCATTCATGAATGTC
AAACACTGGCCATGGATGAAGGTATACTACAAGATTAAGC
CTCTGCTGAAGAGTGCTGAGACTGAGAAAGAGCTGGCAAC
CATGAAAGAGGACTTTGTCAAATGCAAAGAAGATCTAGCC
AAGGCTGAAGCTAAAAAGAAGGAGCTGGAAGAGAAGATGG
TGGCACTGCTGCAAGAGAAAAATGATCTGCAGCTGGCAGT
GGCTTCTGAATCAGAGAATCTCTCAGATGCTGAGGAAAGA
TGTGAGGGTCTGATCAAGAGCAAAATCCAGCTTGAGGCTA
AACTCAAAGAGACAACTGAGAGACTGGAGGATGAGGAAGA
AATCAATGCTGAACTGACAGCCAAGAAGAGGAAACTGGAG
GACGAGTGCTCTGAGCTGAAGAAGGACATTGATGACCTGG
AGCTCACCTTGGCTAAAGTGGAAAAGGAGAAACATGCCAC
TGAGAATAAGGTCAAGAACTTGACAGAGGAAATGGCAGCT
CAAGATGAGAGCATTGGTAAGCTTACAAAGGAGAAGAAAG
CCCTCCAAGAGGCACATCAGCAGACTCTGGATGATCTCCA
GGCTGAGGAGGACAAAGTCAACACCCTGACCAAATCCAAG
ACAAAGCTTGAGCAGCAAGTTGATGATCTGGAAGGTTCCC
TTGAGCAAGAGAAGAAGCTCCGTATGGACCTGGAGAGAGC
CAAGAGAAAGCTTGAAGGAGATTTGAAATTGGCTCAAGAG
TCCATCATGGACCTGGAGAATGACAAGCAGCAGTCTGAAG
AGAAGCTGAAGAAGAAAGACTTTGAAACAAGCCAGCTCCT
CAGCAAGATTGAAGATGAACAATCTTTGGGTGCTCAGCTC
CAGAAGAAGATCAAGGAGCTTCAGGCTCGCATTGAGGAAC
TGGAGGAAGAGATTGAGGCTGAGCGTGCTGCTCGTGCCAA
GGTTGAGAAGCAGAGAGCCGATCTTTCCAGGGAACTTGAG
GAGATCAGTGAGAGGCTTGAGGAGGCTGGAGGAGCCACTG
CTGCTCAGATTGAGATGAATAAGAAGCGTGAAGCTGAATT
CCAGAAGCTGCGTCGTGATCTTGAAGAGTCCACCCTTCAG
CATGAAGCTACTGCTGCTGCCCTGCGCAAGAAGCAGGCAG
ACAGTGTGGCCGAGCTGGGAGAGCAAATCGACAACCTCCA
GCGTGTCAAGCAGAAGCTTGAGAAAGAGAAGAGTGAATAC
AAAATGGAGATCGATGATCTTTCCAGCAACATGGAGGCTG
TTGCCAAAGCAAAGGCCAATCTTGAGAAGATGTGCCGCAC
ACTTGAGGACCAACTTAGTGAAATTAAGTCCAAGAATGAT
GAGAACCTTCGCCAGATAAATGATCTCAGTGCTCAAAGAG
CAAGACTTCAAACTGAAAATGGTGAGTTTGGCCGTCAGCT
TGAGGAGAAGGAAGCTCTGGTTTCTCAGCTCACAAGAGGA
AAACAGGCTTTCACTCAGCAAATTGAGGAGCTTAAGAGAC
AGATTGAAGAGGAGGTTAAGGCTAAGAATGCACTGGCCCA
TGCTGTACAATCAGCCCGTCATGACTGCGACCTGCTCCGT
GAGCAGTTTGAGGAAGAGCAGGAGGCAAAGGCTGAGCTGC
AGCGGGGAATGTCAAAGGCCAACAGTGAGGTTGCTCAGTG
GAGAACCAAATATGAAACTGATGCCATCCAGCGCACAGAA
GAACTTGAAGAGTCCAAGAAGAAGCTGGCTCAGCGTCTGC
AAGAGGCAGAGGAACAAATTGAGGCAGTGAACTCCAAATG
TGCATCTCTGGAGAAGACCAAACAGAGACTCCAGGGTGAA
GTGGAGGACCTCATGATTGATGTGGAGAGAGCCAACGCTT
TGGCTGCCAACCTTGACAAAAAGCAGAGGAACTTTGACAA
GGTCCTGGCAGAATGGAAGCAGAAATATGAGGAAGGTCAG
GCAGAGCTGGAAGGTGCCCAGAAAGAAGCTCGTTCACTCA
GCACTGAGCTGTTCAAGATGAAGAACTCCTATGAGGAGAC
TCTGGATCAGCTGGAGACCCTCAAGAGAGAGAACAAGAAT
CTGCAGCAGGAGATTTCAGATCTGACAGAACAGTTAGGTG
AGACTGGTAAGAGCATCCATGAGCTGGAGAAGTCCAAGAA
GGCAGTGGAGACTGAGAAGGCAGAGATTCAGACTGCCCTG
GAGGAGGCTGAAGGCACTCTGGAGCATGAGGAGTCCAAGA
TTCTTCGTGTCCAGCTTGAGCTAAACCAGGTCAAGAGTGA
GATCGACAGGAAGCTTGCAGAAAAGGATGAGGAGATCGAG
CAGATCAAGAGGAACAGTCAGAGAATTACTGATTCCATGC
AGAGCACTCTGGACTCTGAGGTCAGGAGCAGGAATGATGC
TCTGAGAATCAAGAAGAAGATGGAGGGAGATCTTAATGAG
ATGGAGATTCAGCTGAGCCATGCCAATCGCCAGGCTGCTG
AGGCCCAGAAACAGCTCAGAAATGTTCAGGCACAACTCAA
GGATGCCCAGCTGCACCTTGATGATGCCGTGAGAGGACAG
GAAGACATGAAGGAGCAGGTGGCCATGGTGGAGCGCAGAA
ACACTCTGATGCAGTCTGAGATTGAGGAGCTGAGAGCTGC
TCTGGAGCAGACAGAGAGAGGACGCAAAGTGGCTGAACAA
GAGCTGGTGGATGCCAGTGAGCGTGTTGGGCTGCTGCACT
CTCAGAACACGAGTCTTCTGAACACCAAGAAGAAGCTTGA
GGCTGACCTTGTTCAGATCCAGAGTGAAGTTGAAGACACT
GTACAGGAAGCCAGAAATGCAGAGGACAAGGCCAAGAAGG
CCATCACTGATGCTGCAATGATGGCAGAGGAGCTGAAGAA
GGAGCAGGACACCAGTGCTCACCTTGAGAGGATGAAGAAG
AATCTTGAGGTCACAGTTAAGGACCTGCAGCACCGTCTGG
ATGAGGCTGAGAATCTGGCCATGAAGGGAGGAAAGAAACA
ACTCCAGAAACTGGAGTCAAGAGTTCGTGAGCTTGAGAGT
GAAGTTGAGGCAGAGCAGAGACGTGGAGCTGATGCTGTTA
AAGGCGTCCGCAAATATGAGAGGAGAGTCAAGGAGCTCAC
CTACCAGACTGAGGAGGACAAGAAGAACGTCAACAGGCTG
CAGGATCTGGTTGATAAGCTTCAGCTGAAGGTCAAGGCTT
ACAAGAGACAGTCTGAAGAAGCTGAGGAACAAGCCAACTC
TCACCTGTCCAAGTTGAGGAAGGTGCAGCATGAGCTGGAG
GAGGCTGAGGAGCGCGCTGACATTGCCGAGTCCCAGGTCA
ACAAGCTCAGAGCCAAGAGCCGTGACAGTGGAAAGGGCAA
AGATGCAGCTGAGTGAACAAAGCTGAAGGAACCTGCTTCA
GCACACCTCTAAACCTGTGAAATGAATAAACCTGGACTAA
AATCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations