Transcript

tnnt2c-201

ID
ZDB-TSCRIPT-090929-1259
Name
tnnt2c-201
Previous Names
  • tnnt1-001
  • tnnt2c-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008624 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008624|OTTDARG00000007628|ZDB-GENE-030520-1 tnnt2c|OTTDARP00000007438 tnnt1-001 LG_ BX005210.10 Danio rerio protein_coding KNOWN, 1909 bp
GCATCCATGGAAAACATCTCAGTCTTTGCCACCAGCTGCA
GTGTTCCTCAGTCATCCTCTCTTCTCTAAACCCTCAGAAG
TAGCACCATGTGCGACACCGAAGAGTTTGTGGCAGAGTTC
GAGGAGGAGGTGAAGGAGCAGGAAGCTGAGGAAGAGGAGG
AAGCTGAGGAAGAGGTTAAAGAAGAGGCTGAGGAGAAAGA
AGAAGTTGAGGAAGAACAAGAAGAAGCTGAGGAAGGAGAC
GAACCTGAAGAGACACATCAAGAAGAAGCAGACGATGAGC
ATGAAGCTGAAGAAGACACCAAACCCAAACCCAAGATGTT
TGTTCCCAACATTATACCACCAAAGCTGCCTGACGGGGAG
AAGGTGGACTTTGATGACCTCCACCGGAAGCGTGTGGAGA
AGGATTTTAATGAACTGCAAAGCCTGATTAACCTGCACTT
CACCACCAGGCAGAAGGAGGAGGATGAGCTGGTAGCGTTG
AAGAACCGAATTGAACGTCGTCGGACCGACCGTGCTGATC
AGCAACGGATCAGAACTGAGCGAGACCGTGAAAGACAAGC
ACGCCTCGCTGAAGAACGAGCCCGTCGTGAAGAGGAGGCC
GCCAAATTGCGTGCCGAGGAAGATGCCAGGAAAAAGAAGA
TCCTTTCCAACAAGGGCTACGGCGGCTTCCTGCAGAAGGT
GGATCAGAAGAAAGGAAAGAAGCTGACCGAACGTGAGAAG
AAGACCAAATGTCTGCTAGAGCGTCGCAAGCCACTGAACA
TCGATCATCTCAACCAGGAGAAGCTGGGAGAGAAAGCTCT
CGACCTGTGGAAGTGGCTCAATCAGCTCCACGCTGAGAAG
TTTGAGTTGGGAGAGAAGCTAAAGTCGCAGAAGTATGAGA
TCAAGGTTTTGCGGAATCGAGTAAGTGACCATCAAAAGGG
AACCAAGGTTGCGAAAACCACCAGGAAGTCCTGGAAGTAA
ATTAATCAGATTAATACACAAAACAGAGCCAAAAAGTCTT
GCTTTGAACTTTTCAAGGACAACATTTAACGTTTTCTGAT
TAATGTTTATTCATTTCTCATTGTGCTGTATGACTACTGT
ATGTGTCATTGGTTTTTATTGGGAATAATGTTTTGTCGCA
TGCAAGTCTCAAGCTCATTCTCTAAACATATGAAATGCTT
TTATGTCTACAAGATTTACATTATGCAGAAATGCAGTTTA
TTTTCTAATATTTGAATGTATGACTTTTTTTCTTTCAACC
TTTGCTTAATAATTGTATATTCATTTCACATTGTGCTGTA
TGACTTCTGTATGTGTAATCAATTTTTATTGGGAAAACCT
ATTGTTACATGCAAGTCATTCTGTAAACATTTTCAAAGCT
TTTTTTGTTCACAAGATTTACATTATGCAGTAGAAATGCA
GTTTATTTTCTATGATTTGACTGTGTGACTTTTTATTTAT
TTTATTTATTTATTTTATTTATTTATAAAGTGACAATGTA
CAACATGACATGTTGTGCCAGAGTTAGCTATAAAGCTAAT
TTACATCTGTAGTCCCTGGGCAGGAAGTAACAAATTTAAC
AGTTATAACAAATACAATGTACACTTACAGTACAATAAAT
ACAACACATCGTCAATATAATGAAATCAAATCAATGGCTG
CATATTTGATTTTGTTTTAGCCAAATTTTAAGAACAGTTT
TAAAATTATTAAAAGTGCTGCTCTCTCTGACATACACTGG
TATTTTATTTCCACTTTCTTTTTCTTTCAACCTTTGCTTA
TTAACACAAGTGCTGACAAATATATTGAATTAAAGCAGTG
GTTTCATTTTAGAAATTATGCATTATGTATTGACATCACC
AAGACCTCTTTCAAGACTGAAATCCACAAAATGTGTAAAA
ATAAATGAATCAATAAATAAATAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations