Transcript

snapc1b-002

ID
ZDB-TSCRIPT-090929-12118
Name
snapc1b-002
Previous Names
  • zgc:55475-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029738 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029738|OTTDARG00000022912|ZDB-GENE-040426-716 snapc1b|no_translation DKEY-188I13.4-002 LG_ BX005106.5 Danio rerio protein_coding KNOWN, 265 bp
ATTGTAGGAAGGTCGCTGAGGCAACGTTGTGTGTTTGTTG
ATATATCCACTAATCTATATTAGAAAACGCAGTGCTTGTG
GCTGATCAGCAACATTTCATGACCGATTGATTTGGTAAAC
AAGAGCCAAGAGAGAAAAGGATTTTTGCTCGTCTGGTTCT
GTCTGTGGCGTGTCAGTATTTCTTCCCTCCATTCACTTTC
CAGATCAGAGTCGGGGCCCTTTATCTGCTGTATGGGCTCT
ACAACACACAGCTCGCCACACCCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations