Transcript

snapc1b-201

ID
ZDB-TSCRIPT-090929-12117
Name
snapc1b-201
Previous Names
  • snapc1b-001
  • zgc:55475-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029737 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029737|OTTDARG00000022912|ZDB-GENE-040426-716 snapc1b|OTTDARP00000024265 DKEY-188I13.4-001 LG_ BX005106.5 Danio rerio protein_coding KNOWN, 2028 bp
ACGCTAGAAGGCGGTAGACATTCATGCTTTTCTCATGAGC
TTCTCTAGAAGCATGTGAGAAAACAACAACACAAGTCTCA
CTTTTAACCCGATTTTATGCATTTTTAAAGTGAAGTGACC
AATGAAGTGTTGGTGGTGATTAAATAGCAGGATGGAGCAT
TTCAGGGAAGTGGTCAAAACAGACATTGAAACACTGCTTG
GTCGTCTTCAGGCGGCCGAGTCAGTTCGGTACGAGCAGTT
TCTGGAGATCTGGAAGGACATGGATTTCAGCACAGTGTTC
TTTGGTAAACAAGAGCCAAGAGAGAAAAGGATTTTTGCTC
GTCTGGTTCTGTCTGTGGCGTGTCAGTATTTCTTCCCTCC
ATTCACTTTCCAGATCAGAGTCGGGGCCCTTTATCTGCTG
TATGGGCTCTACAACACACAGCTCGCCACACCCAGAGAGA
AGATTCGCATCGCTCTGAAGGACTGGAAGGATGCTATGCA
GTTTGAGAGGGATGCGATGAACTCACAACATTATGATGTT
ACATATATCTTCAGAAAGCTCCTGTCAGAAAAAGCTTTCC
ACTTTACGGCCATGCCAAACCTGCTCTGCTCTAGGGAAAA
GAAGAAAGATGGGAAGAGGAAAGATGTCTGTGAAGAATTT
GTCGATCCACCGTCACGTCCACAACAGCTTGTTAACACTG
ACCTGCTAGAGGAAATTACAAATATCCACACACATTATGA
GGGTTTGAAGAAAGCTGTATTCACAGAACCAGATCCAAAC
ATGGATCTGATCCAACAAAATCTGGTTCCCAAACTAAGCA
GTTCCATCATTACCTTTTCAACCTGGCAGAAGCATCGCGC
GCAATTTGAAGAGCAGGATCCTGGAGAAGGACCTTCGAAT
CAAGAAAGCTCCAGCAGAGCCCAGCTGCTAGCATCAATCA
AATCCAAATCATACGGACAAGTTGTGGAGGCTTCCAAGTC
CCGACGTCACAGGCAAACAGAGTTGATCCCTGCAGCTGGA
GCAGAGCTGGAGCACAATGTGTCATCAAAAAAGAAAAGCT
CATCACTCAAAGCACGAACTCATTTACGCTTTAAAGCTCA
GGGAAATGACAGTGAGGAGACGACGAGGATGTGGTGTTTG
AGTTCAGTCAAAGAAAAGAAAGCATCAAGAAAACTGGTGA
AAAGATTCAACTGGAAACCTGAAGGTAGCAGCGATCCCAC
TTAACGTTAAGCCCCGCCATCTGGACTGGATGTGATTGGC
GGGCCGCCCAGTGTTAAAAGCTAGTGCAATTTGTTCCTCG
AGCTCCCGTTTCATCTGATTTGTTTTAATCTAATTTTACT
TTTCTGCTCTTGGGTTAAAAGGGCGATAAATAGACATTGC
TTTTGTTTATTAAGCAACACGTGACATTTTTAAGACTGCT
CTTTTAATATTTGTACAGATTTGTATTTTAAGATTTTGGA
GTAGATTACAGTTTCATAAAAGACATTTTCAGAACAATTG
AGCATTTGCTGTTTTTATTGTTATATTAGATGGTTTTAAA
TGTTATGGAGTTAACTTGTTAACAAAGGATCAGTAGCGTG
ACTATGCCTCACTTTTTAACCAATCACCTACTCTATAAAA
CTTATTTAAGGCAGATCAGCTCTCTAGCATTGTTCTTCTC
AATCTTTCAAACCCAACCTCACTCCCTCTATTTGCTTGCT
TTTTATTAACAATCAGATAACCCTCTCTTCCCTCCTAGGT
TGAATCGGGGGGGGGGTCCATTCACTCAACTTAAATATTA
CAGAGACAGTACTCCCACTCTTGAGTCTCTGGGCATCATC
GTAGGATGCCCGATCAAGCGACCTACCTGTTCACTGTTTA
TCCTCGTACTTCCCTTCCCCTTCCTCTCACTATTCCTTTA
CCTTTCCTTTCATCCTTACAATAAAGTCAAGCTCAAAGTG
TGGCGTAGTCCATGCTGGTGAAATTGATTTTATGATTCAG
AAGTTTGCATTTCATCACTCAACTTTTTGTTGTATATGAG
CCAACTAATAGATCTCTGGTGCACTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations