Community Action Needed: Please respond to the NIH RFI
Transcript

yipf4-002

ID
ZDB-TSCRIPT-090929-12002
Name
yipf4-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029619 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029619|OTTDARG00000022853|ZDB-GENE-040426-2253 yipf4|no_translation yipf4-002 LG_ BX511245.6 Danio rerio protein_coding KNOWN, 654 bp
CAGCAGTCGCGTCCGAAAGCTGATCGGTAGGAATCGTTAA
ACGTGGCAATGGTGTGAAGGTGCGCGTTCGGCGACGGTGT
GTGAGATTGTGAGCGAAGCCCGAGCTGTAATCACTGTCAG
CCATGCAGTTTTCTCCCACCAACGGAGATTTTACCTTCGT
CTCCTCGACGGACGCTGAAGAGCTCAGCGGCACCATCGAT
GCACCAGATATCACACTAAATATGGGCCCGGAATCCAACC
GGGACACCTATGCCACCACTTTCCTGAGGCAGAGGGGTTA
CGGATGGTTGCTGGAGGTGGAAGAAGAAGAATCAGAGGAC
ACTAAACCACTCCTGGAGGAGCTGGACATTGATTTAAAGG
ACATCTACTACAAGATCAGGTGTGTGTTGATGCCCATGCC
CTCACTGGGGTTTAACAGACAGGTGGTGAGGGACAATCCT
GACTTCTGGGGCCCCCTGGCTGTCGTCCTGCTATTCTCTA
TGATCTCCATCTATGGACAGTTCCGGGTGAGACACAAGTT
TCTGTGCATGATTATACCCGTGATCTTTGTGTAAATAGAC
TTCTAGAAGAAATGCTAAATGGATTGCCGTAGATTGTAAG
CTTGTGAAATTGTATCTTCAGGAACATGCAAATAAAAGAA
ATTGTTTGGGCTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations