Transcript

yipf4-201

ID
ZDB-TSCRIPT-090929-12001
Name
yipf4-201
Previous Names
  • yipf4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029618 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029618|OTTDARG00000022853|ZDB-GENE-040426-2253 yipf4|OTTDARP00000024171 yipf4-001 LG_ BX511245.6 Danio rerio protein_coding KNOWN, 1796 bp
AGCGTCACGGGGGTGGTGCTGTGATTTGTGTGTGTTTCGT
CGCTGCTCGTTTCTAGCGCTGGGTGGAGCGCGTGACTCTC
CGTTCCGCTCCGCTCCAGGATTTGACGTGTCGTCTGTGTT
TTTCTGCACTTCCTGCTTCCTCCATGACTGTTTTGAGCCA
GCAGTCGCGTCCGAAAGCTGATCGGTAGGAATCGTTAAAC
GTGGCAATGGTGTGAAGGTGCGCGTTCGGCGACGGTGTGT
GAGATTGTGAGCGAAGCCCGAGCTGTAATCACTGTCAGCC
ATGCAGTTTTCTCCCACCAACGGAGATTTTACCTTCGTCT
CCTCGACGGACGCTGAAGAGCTCAGCGGCACCATCGATGC
ACCAGATATCACACTAAATATGGGCCCGGAATCCAACCGG
GACACCTATGCCACCACTTTCCTGAGGCAGAGGGGTTACG
GATGGTTGCTGGAGGTGGAAGAAGAAGAATCAGAGGACAC
TAAACCACTCCTGGAGGAGCTGGACATTGATTTAAAGGAC
ATCTACTACAAGATCAGGTGTGTGTTGATGCCCATGCCCT
CACTGGGGTTTAACAGACAGGTGGTGAGGGACAATCCTGA
CTTCTGGGGCCCCCTGGCTGTCGTCCTGCTATTCTCTATG
ATCTCCATCTATGGACAGTTCCGGGTTGTTTCCTGGATTA
TTACAATCTGGATATTTGGGTCATTGACAATTTTCCTTCT
TGCAAGAGTGCTGGGTGGAGAGGTATCTTATGGGCAAGTG
CTTGGAGTTATTGGCTATTCTTTGCTCCCATTGATTGTAA
TAGCTCCGCTTCTTCTGGTCATCGGGGGATTTGAAGTAGT
CTCTACACTCATAAAGCTTTTTGGAGTATTCTGGGCTGCG
TACAGTGCTGCTTCGTTACTCGTCGGTGATGAATTCAAAA
CGAAGAAACCCCTCCTCATATATCCCATCTTCCTTTTGTA
CATCTACTTCCTGTCTCTGTATACTGGAGTCTGAATTGAC
CACAGGCTTTGATTGGCTCGTTGCTTGGACATTAACACAG
AGCACTGTGGAGAGTTGCACAGCAGGGATATTCCATGAAG
ACCGAGGAGGAGTTTGCATTTTCTCGCTTTCTTTTACCTT
GTTTATAGTCCTATATGCTTTGGGGGGGGTCGAGGTGTAC
AGACATTAGTGTATTTAACTGCTTTCATTAATTTTGTACA
CAATAAAAAGCTGCATCTTTTACTGTGGAAGCTGTATTTG
CAGAGGTTACTCTGCCATTGAAATGTGGAGCCATGGTTTT
ACATAACAATTACAAGCACCAACAGGAAAATAAAAATGAA
AACTTTATATTGTAAAAGACTATTATAAGCATGATAAATC
ATGTAACAGAACTTGTGTTTTCCCACACATAATGGTGAAA
ACTTTACGAGTTAACCAGTTTATGATAGATGGATATTTTT
TGTTGTAGAGTGAGCCAAAACATTCACAGATTCCATTTGT
TTTTAATTTATGAGTTCCACATGGGGAAAGAGAGTGTGCA
GGCAGTACTGCTTGGATTAAAAATGTCCGCTAAGTATGGG
TGCCTTAAATTGGTTGTTTTATATGGCTGTGGTGTATTTT
ATTTATGTAAATGTAGCCAAAAAAAAGGAAAGGAATTTTT
ATTTGTAGATCATGCAATTGAAGACAACTTTCTACCTGGT
GATGTGTACACTGCAGGCATATGTTACCGTATTAGTATAG
CTAAAATAATGGAGTATGAAAATTGTTATAATAAACATCA
TGAATCAAATTAAAATCTGTTGACACTGTAATTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations