Transcript

zgc:100829-004

ID
ZDB-TSCRIPT-090929-11718
Name
zgc:100829-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029308 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029308|OTTDARG00000022677|ZDB-GENE-040801-54 zgc:100829|no_translation CH211-113H10.1-004 LG_ BX511240.5 Danio rerio protein_coding KNOWN, 1414 bp
ACACTCTTACGCACCCATAACCGTGTACACACACACTCAC
CAACTACACCCAGCTGCGTCCCTGCTCTACTTCCTGCGCC
GACGACCTCCGGTCTGGCAGTCAGCAGCCCAGGAAAAAAA
CACACTGAATGAGAGCAGAGAAAGAAAAAAAAAGGATAGA
ACAGAGTGCGAAGTGAGGGAAAAGGGCAGAAGAAAGGTGA
TATCCGAGTGGTTGCCGCCTCTAAACGGGTGTTCTCAATG
GATTTGGGGTCCGAGGTTGTTGAAGAGAGCTGTTTGGGAC
GAGGAAGGGTTGCTCAGCTCATGAAAACCTTCAGCGTGTG
CGGCGAGTCTCCACCCTGTCAGTCTCCGCCCCGTGCCAAT
AAACCTCCAATCCCGGAAAAACCGAACCACTTGAGGCTCC
GCCCCTCACCCTCTCTCAGGTAATCCACATGGGACAAACC
CCTGAGCAACAATCAAGACAACTAAAACAGGGGTCTTTAT
CAGCGGCTACAATGAAGGGTGTGGGTGCTCGGCCTTTCTC
AGGAACTTGAATATTTAGTTGCCAAAGTTATGCTTTTTAT
TTTTGCAATATTGATGTTTTTCTTCATTATTTGTATTTTT
ATATGGTATGAGAGGTTTGCAAAACTTTTCAGCAGGAATG
ACACACTCGATATTTTGTTACATCGCTCCAATTGTTGACC
TGTCTAGCTCATAATGCACTCAGACTCATACTTACAAGTG
TGTTTCTGTTTTAAAGGGTCACATGATATCTTACTCAGAT
TGAGAACTCGTAATGAGACCAAATCATGATCGTAATCCAA
AGTTAATCATCCCATTGGTTTGTTATGTATTAAATATGTT
GCTTCCTTGAAGTATTGAAGGCTGGAGTATGCATGAAGGC
TGTCTTGATTTTGCGGAAGTGGTCGTACAATGTCTTTGAT
ATCAGTAGATGTCCAATATAATGGCTGTATGTACTGTAAA
TTTCAATTTCAGCAATTAAGATGTTTACATCGCTAAATTG
AAACGAATGCATGCTTTACACAGTGTTTTCTAAGTTCACT
TAAAATATTATAAAGATCACCGACAAAGCTTTGTTGGACT
GACCAACTGTGCCAAATAATCGGATAATATCTGATGCATT
GGTCTGTCAGTATTCATATGTTGCTGTTTTCTTTATTATT
TCTTTACATGGAGGTAGCTGATCATATTGCATTCAAACGT
TCCTTCATCGGTAACTAGGTCAGTAGGGCAGGAATCACCT
TCATGTAAATAGTTTTCTCACAGACACATTTGCTGGCACT
TAATTCTGGGGTTTTTACATGTGATCTGGAACAGTTTATA
AAATTGCTCTGTGTAAAGCTTGAATGTCCTGTCCACACAC
ACACACACAGGATAAGTGTGGGATATTGCCTCTGTAATAA
AATGATCAAACCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations