Transcript

zgc:100829-203

ID
ZDB-TSCRIPT-090929-11716
Name
zgc:100829-203
Previous Names
  • zgc:100829-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029306 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029306|OTTDARG00000022677|ZDB-GENE-040801-54 zgc:100829|OTTDARP00000023935 CH211-113H10.1-002 LG_ BX511240.5 Danio rerio protein_coding KNOWN, 849 bp
ACCAGCTAAGTCATACACAAAGGCAAGAAGGCTCACTCTC
TCACTCACTTCTCCTCAGTAAAGTCTGCCGTGGAGCTTCC
GCGCCCAGCTTGTGTCCTCTGTATGGCTGCCGGTCAGTGA
TGCGAGCACGTGTGTGGTGAACAGATCCGTCTTCATCCTC
ATCTTCATCCTCCATCTGAAGTTTTCGGGATACATTAAGG
AACTCCACACACTTGGCCATGCTGCAGCAGATCCTGAAGG
ACATGTACATCGACCCTGATGTGCTGGAAGCTCTGAATGA
CGAGCAGAAGAAGATGCTCTTCCTGAAGATGCGCGAGGAG
CAGGTGCGCCGCTGGAAGGAGCGTGAGGAGAAGCTGGAGA
GGGAACCGCTCAAACCCAAAGCAAAGACAGCTCATAGTAA
GAGTGTCAGTTGGCTGCTGGGACGAGATGGAGACGTGCAG
GTCATTGTCATTGGAGAGATGGATGAGTTTAAATCTTCGA
AGATCATCTATTCAGGATTTGGAGAGAGAAAAACAGCCAG
CGTCCTCAACAATTCATACAATCAGTCCAGCACTTTGAAG
AGCAACCTGACAAACCGATCATCAGCAGAACCTGCACGAT
CAGGGCGAGAAAACCTCCCTCCTAAAGCTCGCTCAGGAGT
TCAGCTGAACTTTAAGGTGACCTTCCTGTTGCCGCCATTA
ATCTCGGACACAGCCGAGGGCCAGCGAGACGGACTTTCTC
CACAGGGAGAGTCATCGCTCAACAGCCAAATAAATCACAG
CCTCCATCTCTCCCTCTTTTTGCACCTTCCCTTCCCCTTT
CCTCCTTTTTTCATTGCCTTCTCCTCCATTATTCCTTTTC
ATCCTTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations