Transcript

taar1b-201

ID
ZDB-TSCRIPT-090929-1165
Name
taar1b-201
Previous Names
  • taar1b-001
  • si:dkey-7c18.14-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008166 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008166|OTTDARG00000007253|ZDB-GENE-041014-58 taar1b|OTTDARP00000007208 taar1b-001 LG_ AL929507.37 Danio rerio protein_coding KNOWN, 1000 bp
AATGGATCTCTGTTATGAGGCGATGAATGGATCCTGTTGG
AAATACGTACGACCGCATGCCATCCACGTTCCGATGCTCA
TCGCTATTATGTTGATCATCTCAATGACCTTCATTGGGAA
TCTACTGGTCATCATCTCCATTGGACATTTCAGGCAACTC
CACACACCAACAAACCAGCTGATTCTGTCTCTCGCCCTGT
GTGACTTTCTGATTGGGTTGTTTGTGATGCCTCTGAGTGC
TGTTCGCTCCATGCAGGGCTGTTGGTACTTTGGCGAATTC
CTTTGTAAGTTACACACATGCATTGACATCACTCTCAGCA
CCTCTTCCATTTTCCATCTTGTGAGTGTGTCTGCTGAGCG
CTTTTGTGCTGTGTGTGGACCGTTAAGGTATCGTTCCTGT
TTTGGATTGTCAACGGTGCTGTTGATGATCTCCATCAGCT
GGTTGATCCCTGGAATATTCGCTTACGTGATGACTTTCCT
GGAGATCAACATCCACGGAGGCAAAGACTTCTACGATGCT
CATGTACGCTGTGTGGGAGGATGCCATGTGTTTTTTAGTC
ACGGTCCGGCAGTGTTCACCTCTGTGTTTTCCTTCTACAT
CCCTGGCTTCATCATTGTTGTCATCTATTCTCGAATCTAC
ATGGTCGCCCGAAACCAGGAGAGATCTATTCGTCTTCAGT
TAAACCAGTTGAGGCGGGTTTATCCATCAAGAGATGTGCA
GCTTCAGACACGCAAGGCAACTGTCACCATTGCTATTGTG
GTTGGAGCTTTCCTGGTTTGCTGGACTCCCTTTTTTCTGT
GTAATATCCTCAATCCTTTTATTGGCTACGCGACACCGCC
AATGCTGATTGATGTGCTTATGTGGTTTGGCTATGCTAAT
TCCACGTTAAATCCTTTTATTTACGCATTCATGCATTCCT
GGTGTCGAAAAGCGGTAAGGATTATCGTAACTGGAGAAAT
ATTTAAAAACAACAGCAGCAGAAAAGACTTGTACACTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations