Transcript

cldn2-201

ID
ZDB-TSCRIPT-090929-11591
Name
cldn2-201
Previous Names
  • cldn2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029167 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029167|OTTDARG00000022606|ZDB-GENE-040912-26 cldn2|OTTDARP00000023835 DKEY-38K9.2-001 LG_ BX530030.12 Danio rerio protein_coding KNOWN, 1873 bp
CAGAGGTGCTTGTGTGTTCATGGACGGGGCAGATCCTCAT
ATCTACAGATCAACAGAGATGGCAGGATCACAAACAGAAG
GACTGTGGGAAAACACAGGCACATATGAGTGAATTAAGAG
CTGCTGGCAACACCTCACTGCTGAACATAGCAATCCAGCA
AAACTTCATCAAACACTTCCTCCAGCACACAACATGGCGA
TTCTAGCACTGGAGTTGATGGGTTTCTTTTTTGGCCTCAT
CGGCATGCTTGGGACCCTGGTAGCCACTCTTCTCCCCTAC
TGGGCAACATCTGCACACGTTGGCCCCAATATTGTGACCG
CAGTTGTCAGCATGAAGGGTCTTTGGATGGAGTGCGTTTA
CCAGAGCACTGGCGCCTTCCAATGCGAGACTTACAACACC
CTCCTGGGACTAACCGTCGACCTGCAAGCGGCCCGGGCCA
TGATGGTCATGTCCTCCATCTTCTCCGTCATGGCCTGCGC
CGTTTCCACCGTTGGCATGCAGTGCACCGTCTGCATGGAC
GGATCTTCAGTCAAGACCAAAGTAGCTGGAGTTGGCGGCT
CCATGTTCCTCCTGGCTGGGCTTTTATCGTTGATTCCCGT
CGCCTGGAAGACCCACGAAGTGGTGCAGACCTTCTACATG
CCCAACATGCCAGCCAGTCTTAAATTTGAGATTGGCGATT
GTCTGTATGTAGGTTTAGCTTCCTCTCTTTTGTCCATGCT
TGGTGGCGGACTATTGAGTGCATCCTGTTGCGATGACATA
GATGGAAACAGGGGATCCAGACGGCATTATCCCTATCCAG
AGCGGAATGCCTTGCGTGGGCCGTCCCATTCAATGACCTA
CCAGCCAGCCGCTCTACATTCAACCACAAACCCCAACATT
ACCAATAAGACGCAGACTCTTAATAGTCACACAAGCTCCG
GTACCCACTCCATTCAAGCCCAGGATTCAAGGAAAATGAC
TCGGCAAAACACTGCGGCTGGCTATGATGTCACTGGCTAT
GTTTGAAGATTTGTGTCGGCCAGTGCAGTTGAGTTTTACA
TAAAGTGATTAATACTTGGATTGCTGAAAGGCTCAGAGAA
TGTAGACGCTGGTAGAGCATGAGGAAGGGTGTGTGTGTGT
GAAGGTCTATGAGGTGTGTTTGGCTTCTTTTTTGCATAAT
TGTCTTTTTTAGGAGTTTCAAAATGAAAACAAAATAGCAA
AATGATTTAATGATTGTATGGATTGAAGGTGGTTTGTAAA
CACGCAAGTTAATATTTTAGTTGTCGTATAAGAAGAACCG
TGTCAATTAGCCTTCTTAAAGGGATAGTTGGCCCAAAAGA
GAAATTTAGCAGCTAATTTACCCTACCTTTAGGTGTAGTT
TTTGTTGATTTTGAAAGAAATACTGTTCGTAAAAAAAGCA
TGGTTCTCGCTGATTCATAAATGGCAAGTCGAGTTGCACT
TTTAGAGTAAAAATATACTTATAGGCAAAGCAAAATTAAT
ACCTGAGGTACTAAATAAATAAGTAGCCTGTGCTACCTGT
TAATATCTGATACAGTAATGTCTCGTGAAGTGAAATTATC
AGTCTGTGCAGCAAACTGAACGTTATTTATACCCTAGTTT
TGGCTAAAAATTTTATTTAACGTGCTGCTGAAGAAAAATG
TCTCCCACTATATTGTCCTAAAGGTGAGTAAATTACCGGC
AAGAGCGAACTATCCCTTTAAGAACATTTTTTATATTCAA
ATGCTTGTTTTTTATGACATTTAAATACATTGGTTTTATT
TGTTTCTAATAGCAGTCTTCACTTTTCACTGTTTCTAAGC
ACCTATATGCACTCGGTTGAGCACTTAAGGAACATATTAA
CCTTGTAAATAAAATTTTGAGTTGTTTACTAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations