Transcript

serpinf1-201

ID
ZDB-TSCRIPT-090929-11566
Name
serpinf1-201
Previous Names
  • serpinf1-001
  • zgc:92072-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029140 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029140|OTTDARG00000022590|ZDB-GENE-040912-2 serpinf1|OTTDARP00000023815 CH211-221P4.3-001 LG_ BX248108.11 Danio rerio protein_coding KNOWN, 1946 bp
ACAGTTGGCGGAGGCAGCTGAGAACTGAAAATCTGCACGG
AGCGACGGTAAAGAAAACAGGATGAAGAAGATAGTTCTGC
TCGTTGGTTTGTGGAGTCTCCTCTCCCTCTCACATGCTCA
GTTGGCAGACACAACAGATGCAGAAGGTGAGGAAGAAGCA
GTTGACCTTTTTACCACTCCACGCACCAAGCTGGCTGCAG
CAACCTCTGATTTTGGCTACAACCTGTTCCGTCAGCTGGC
ATCGCGTGACACCAAGGCCAGCGTCTTTTTATCCCCCATG
AGTATATCAGCAGCCTTTACACAGCTATCAATGGGAGCGT
CTGAACGGGCCGAGAAGCAGATTTACAGAGCCCTTCGCTA
TCACACACTTCAGGACAGTCAGCTCCATGACACACTCAGA
GATCTTCTGTCCTCACTCAGAGCATCAGCCAAGGGCTTCA
AGTCAGCAGAACGCATCCTTTTGGCGAGGAAACTTCGTCT
AAGGCTGGAATACCTTAACAGCGTTGAGAAGCAATATGGT
GAACGGCCTCAGATTCTTGCTGGTGGAGCCCGGGACCTCA
AGACTGTTAATGACTGGTTTAAACAGCAGACTGGAGGAAA
AGTGGATCAAGTCGTTCCTTCCCCTCTTCCTCGTAACACA
GCTCTGCTGCCAGTCGGATCTGCCTATTTTAAGGGTAAAT
GGATAACTAGATTCGGCAAACCTAATAAGATGGAAACCTT
CAGGAGAGATGGACAAGCACCTGCTGTTATTCCCATGATG
GAGCAGGAGAATTACCCAGTGAAGATGGGTATCGACTCTG
ACCTCGGCTGCACGATAGCCCAGGTTCCTATGGAGGATGG
AGTGAGCATGTATTTTTTCTTACCTGATGAGGTCACTCAG
AACCTGACTCTAATAGAGGAAGCACTTACAGCTGAATTTG
TCCAGGACCTGTCAAATTCACTCCACACGGTGAAGGTGCT
GCTCACACTCCCAGTTATCAAACTCAGCTACAAGACAAAC
CTGCTGCCCTCCCTCTCTGACCTGGGTCTATCTGAATGGT
TAGCAGAAACAGACCTTACCAAAATCACCAGTCAGCCAGT
CAAGCTGAATGCAGTCCATCATAAGGTTGTCCTGGAGACA
GCTCCAGAGGGCGCAGAGTATGCCAGCACCACACCCAGTG
CCACAGGTCAATCGCTGGGTCTATCGTACCGTGTGGACCG
GCCCTTCCTTTTTCTAGTCAGGGATGAGCCTTCAGGTGCA
CTTCTCTTCATTGGGAAAGTGCTGAACCCAAGTGATCTCT
AAAGGGTATGAGACAGAAACACACATACACTCGCACTTAA
ATGCACAGGAGGCACCAGCAACTTACACGAGCTCATTTTA
AACCCAAGTCTATACCCAAAATATAAATATTTTCATATAC
AGTGGCCATTTGGAGAAAAATGATCACAGCCAGCCGCATT
TTTAACATGCTTATGCAGTACACACTCAAACATTGGTATG
TGCAGCAGACATTCACAGTCGAGCCATACTAAAATATTCC
ACTTGTGCCTTTGATTTGGAATATTTTATGCACAAGGCTC
AGTGTAAATGTTTTGGATTTTAGCCAGATGATTTTAATTC
ATTTTGATGATTAATAACTTGATGCTCACAAATATAACTC
AACCTTTAAGTAACTAATCTTTTAGCAAACATCCCTCAGG
TATTTACAGCTGCTAATAATGATTATGCAATTAATGGTAT
GCATCTCAAAAGCATGTTGTTATGACCATCTTCTTTTCTG
TAACGATTTGTTTGAGTATTTGATACGTTTGCCTTATGAC
TTTACTTAACAGTCCCTCAGAAATGTTCAAATTACACTCA
AATCAAGTTCAGATCACATTCCCATATGTACATTTATCAC
CAGCTAAGATTATACTGAATTTGTATATTATGTTGATTCA
AATAAAGGAGAAATACTTGCAATCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations