Transcript

slc7a2-201

ID
ZDB-TSCRIPT-090929-11512
Name
slc7a2-201
Previous Names
  • slc7a2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029082 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029082|OTTDARG00000022558|ZDB-GENE-041212-5 slc7a2|OTTDARP00000023777 slc7a2-001 LG_ CR384105.16 Danio rerio protein_coding KNOWN, 3627 bp
TTTGAGCTTGAAGAAGGACGGGGCAAACTTGACACAGGAC
TTGGGAAGGACTGACTTCGAGCTTGTGAGCTTTTTAAAGA
AATCAGTGGAGATCACTGAGAGCTGTGTGTGGTTGGGGGT
GTGTTCCTGTGTATTTGGGCGAAAGCCATAGGAACTTTAC
TTCCATAGCGTGATCCTGCAGCTGCCAGTCAGTCATCAGT
CGGAAGAATGCTAGAACATTGCCTCACATTTGGTCGCTCC
CTTGTGAGGAGGAAGAATGTGGACCAGGGCTGTCTGGAGG
AGTCCAAGCTGTGCCGCTGCCTCTCAACTGTTGATCTCAT
TGCTCTGGGGGTTGGAAGCACACTGGGGGCCGGTGTCTAT
GTACTCGCTGGTGAGGTGGCCAAAGGCAGTTCCGGCCCCA
GCATCGTTGTGTCCTTCCTCATCGCTGCATTAGCATCTGT
GATGGCTGGTTTGTGCTATGCTGAGTTTGGTGCCCGGGTA
CCCAAGACTGGCTCTGCCTATCTGTACAGCTATGTGACGG
TAGGAGAGCTCTGGGCTTTCATCACCGGATGGAACCTCAT
TCTGTCATACGTCATCGGCACTTCCAGTGTGGCACGTGCC
TGGAGTGGGACATTTGATGAGATTATAGGCGGTCACATTG
AAAAATTCTGCAAAATGTACTTCAAAATGAGTTTGCCTGG
CCTGGCGGAGTACCCTGATTTCTTTGCTGTTTGCCTGATC
TTACTTCTGTCAGGCCTACTCTCCTTTGGGGTGAAGGAAT
CAGCCTGGGTCAACAAAATCTTCACAGCAGTAAATGTGCT
TGTGCTCATGTTCGTTATCATCTCTGGATTTGTCAAAGGA
GACTCTCTCAATTGGAACATATCAGAGGAATCGCTCGTAA
ATTACACAGTTGTCAAAAGAAACATCTCGAGTGCTGCTAA
TGTCACCAGCGATTATGGGGCAGGAGGCTTTTTTCCGTAT
GGATTTGGCGGAACGTTGGCTGGTGCGGCCACCTGCTTTT
ACGCCTTTGTGGGATTCGACTGTATTGCAACCACAGGTGA
AGAGGTGAAGAATCCCCAGAGGGCCATTCCCATTGGCATA
GTGGTTTCCCTTCTGGTCTGCTTCCTTGCCTACTTTGGTG
TTTCAGCAGCCCTCACCCTCATGATGCCCTACTATCTGCT
GGATGAGAAGAGTCCTCTACCTTTGGCTTTTGAGTATGTA
GGCTGGGGGCCTGCAAAATATGTAGTTGCGGCAGGATCAC
TTTGTGCTCTTTCAACCAGCCTGTTGGGCTCAATGTTCCC
CCTGCCCCGTATTCTGTTTGCCATGGCACGAGATGGCGTG
CTATTCAGATTTCTTTCCAAACTGAGTAAGCGCCAGTCGC
CAGTGGCTGCCACTATGGCAGCAGGCACTACCGCGGCTAT
CATGGCTTTTCTGTTCGACTTGAAAGCGCTGGTGGATATG
ATGTCTATTGGAACATTGCTGGCTTATTCCCTTGTGGCTG
CTTGTGTTCTTATACTCAGATATCAGCCAGATGCTTCGTT
CGAGAGGTCGAGGATCAGTGAAGGGAAGGAGGAGGTCGGA
GAGTCTGAACTGACAGAGTCTGAGTCTCATCTGAACATGC
TGAAGGATGGAGGAGTAACGCTGCGCTCTCTGCTCCATCC
TCCACTGCTGCCCACTAAAAATACCTCCAGTGTGGTCAAC
GTGTCTGTCATCATCACAGTGCTGGTTGTGTGTGTTGTGA
GCACACTGAACACATACTACGGACAAGCCATTATTGCAAT
GGAGCTTTGGGCACTGGGAGTATTAGCTGCATCACTGTTC
ATCTTCATCATATGTGTCTTTCTTATTTGTAGACAACCAC
AAACAAGGAAGAAGGTTTCCTTTATGGTTCCTCTTTTGCC
CTTTCTACCCATCTTGAGTATATTTGTCAATGTGTACCTC
ATGGTTCAGCTCAGCGGAGACACGTGGATCCGTTTCTCCA
TCTGGATGGCCATAGGTTTTCTCATCTATTTCGGCTATGG
GATGTGGCACAGTGATGAACGCAAGCGACATCTACAGAAC
TGTGCTGTCGCAACAGAGAAAAAGACACTGACCGGAAATG
AAGGCTTTGTGGAGAACAAGACACACACAGAGAAGACCAG
CCCATGCTAAAGAGCAGAAGACCAACTCTCACTTTAACTA
TAGCTGTTATTCACAGCGTTCCCCAGCCGGCTGACAGACG
TAAGCTCTGTGCTTTCAGTCACTGCCGTCATGAACAATTA
CTGAAACACTTCTCACTGCTGATGTGAGTTTATAATGTAG
TACAGTAGGTCATTAGGGGGGTACGATCTGACAAAACCAA
TGCTTCGATTATAGAAATGACCCTCAAAATAATGAAAATC
AATATAAATTGTCATTTGACTTATATTCATGGTAGTTTCC
GATAATAATGAATAGTGACCAAATGATTTTTGTATACTTG
GATTTCTCATCGCAATATTTAGAACTTTTTAAATAGCATT
GAAGGGCTGTCAAATATTTACAATCCCTTGAAGACAAACC
TCAGCATGTGAGTGATTTGATTTCAGTGTTTGGATGAGAA
AGGGAAAGCTTGTGCCTTTTTTTCATTACAAAAAAGTATT
ATGATTTCTGCAGTCAGTCTCTCAAGTTTACTTTTACTGT
GAAAGTAAATATAACAACAGTAATATTTTACTACAGTATT
CTTAGTTGGGAGAAATAAGTGTAAAATGATAAGTGTCCTT
ATCGAATGTGGGATATTAACACTTTAAAAAATATTTGTAA
ATGGACAGTTTTCCCTATTTTGAGATTTATGTTTTTCCCC
TCTTATTTATGCTTTTGAATTGCATTATTGGACCTTAATT
TTTACTTCAAAAGATTTGGATGAAAATTTGTCCAAAAAAA
AGTCAATAAAATTCACTTTGGTAAACTGTAGAATTTAATT
TTCAACATAAAAAGTGGACAGAGCTGAGATAAAACTCACA
TAATGCAATTCACAACCGTAAATAAACATAAAACAACAGA
TGAATAATTAACAGATTTTTTTCAGTGCAAATAATGGTCT
AACTTTGATTTAGAATTAATTCTATTGACTACATCTTTCT
GAATGTGCCAGAGATGTTAAGCTGCTCAGATAAAAAAATA
ATAATAATGTTTTCTTGTATTAAACACTAGTTCCTTATTT
TTACCCACGTTATTTGTGTTAGCATTGAATGTTTGACAGG
ACATTCTACTACAGTATTCATACAGTAGGTCAACCTGTTG
TTTAACAACCATAAGGTTTGAAGACGTTAAAGAGGAGCAA
GTAATCAGTGTTTTGTCTTGTACAGTTACGTTTATTCAAT
TTGATTTCTTTCTATATTTGTTTACTTCACAGAGACTTTT
ATTTTGTTTTTGATGAATAACAATCATTGGCTGTTGTCGT
TTGAAAATTGACAATCTGTTTAATTCAGTTAATGATGGAA
AGTGTTTCTTCTGCTAACTAATGGTCTTCTGTTGTGCCAC
TAATGCATGAATGTATTATTTTGTTTTCTCTTTAGAGCTT
GTGTATAGTTGTTTTAACCTTTTTTAGTGAGGGAAGTAAA
GTATGGATCGTCATATCAATGCAGAGTGGTTTCATACAAA
GCAATAAAAGATTCCTTTTTTTAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations