Transcript

msgn1-201

ID
ZDB-TSCRIPT-090929-1138
Name
msgn1-201
Previous Names
  • msgn1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008053 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008053|OTTDARG00000007157|ZDB-GENE-030722-1 msgn1|OTTDARP00000007114 msgn1-001 LG_ BX890562.8 Danio rerio protein_coding KNOWN, 1971 bp
AGCCGCTCGGACACGCGCACGTGTGAAGCTCGTCTGATCG
CATCAGTGCGCTAATTGTCGTCGAGTCCTGTTAAAGGGTC
ATTTCCCACAAAAGGGAATCTAATTATTTTCTTTTCTCCT
TCACATTATCCGCCAACATCACCTTATTCGCGCACGGGTG
TCAAGCGCGCGTCCGCCCTGCGCGCCTTTGAACTCCGCGC
TCGTAAAGTTTTGCGGTATAAAAGCGCAGCCCCGCCGCAC
CTGCACATTTCTCTAACCGTCCGGACATGGCGCAAATCGA
CGTGGATGTGTTCACAGCCAAGGTTTTGTCCCATTGGGAC
TGGAGCCGTGAGGACAGGTCATTTGGAGACAGCGCGTCCT
CGCCGGAGTCCGAGTCCTTCGATTCTGCCTGCTCGTCGCC
CGACGCGCGCTCCAGCCCCACAGCAGGGTGCGAGCATGCG
GAGCAGCAGAAGCCGAAAGTGAAGATGAGTATGAGGAGGA
GGATGAAGGCCAGCGAGCGGGAGAAGCTCCGCATGAGGAG
TCTGGCGGAGGCGCTGCATCAGCTACGGGATTACCTTCCG
CCGGGGTACAGCAGGAGAGGACAGCCGCTCACCAAGATCC
AGACGCTCAAATACACCATCCAGTACATCAAAGAGTTATC
CGGCATCCTCGAGCAGCAGTGAGACCCGCGGGAAACCTTC
CCACAACGCTTTAGGAACGTTTAGACAACGTTGTTTCGAG
AACGTCATTTTCGAATGTTCCTTTTTGAAAAAATGTTTCA
GGAAGCTTTTCGAAGATGTCAAAACAAAGATTGAAACATT
CGAACATGGGCATTCGACATTTCGACTTATGCGCAAAAAA
CCTACAGACAACGAACTTTATTTTACGAACACTATTTTTA
ATGTTCGCTTTTTAAAGATGTTTGAGGAAGTTTTCCAAGT
TGTAAAGATGCTCTGAAGAAGAAAAACTTTCGAACATGGA
CATTCGACATTTCGACTAGAAAATCGACTTTCTTATTCGA
TTATATTTCTCGACTTTCATATTTGATTATGTTTCACGAA
TGTCATTTTCCAATGTTTGCTTTTTAAAATGTTTCAGGAA
GTTTTAAAAAGTTGTGAAGATGTCAAAAAACAAACAAACA
TTTGAACATTGGCATTTGACATTTCGACTGTAAGAAAATG
TTTCTCAAAAAACGTACAGACAACGATATTTTTCAATGTT
CGCTTTTTATGTTAGGAAGGTTTTCTAAGTTATGAAGATG
TTCTGCAAATATCACGGGAATGTTCATTTCAAATGTTTTA
TGAACGCTTCAAAAACACTCAAACATGAACTTTCGACATT
TAACTATGTTCCTCAAAAAAACAAAAACATACAGACATTG
TTATTTGACGAATGTTATTTCTGAATGTTCACTTAAAAAA
AATAGGATTCGGGAAGTTTTTCTATGAAGATATTCTACAA
ACATCCTGGAAATGTTACTTTTCCAAATGTTTTCTGAACG
TTTAAAAAACATTTAAACATAAACGTTCAATTAAAGAAAA
TTCCAAAAAAAAAAAAAACGTACAATGTTATTTATGAATT
TTCTCTTTTTAAAATTACTTTCCAGGTAGTTTATCTAAGT
TGTGACAATGTTCTGCAAGCATCCTGGGAGTGTTACGTTT
GAAATGTTTTTGAACATTCTACTAAACTGCTCCCAAAGAA
TTTTCACAAATATTCGAGAGCATTATTACATCTTTGAGTG
TTAGTGGAGGAACGTTTGCTCATCATATATTTGTGAAAAT
GTTATGCGAACATTTCATGATTTTCGGCTGCTGTTGTACA
GATTTACATGTTGTTTGTTTGTTTGTTTGTTTGTTTATCC
ACTCTGATGTGTTTATTTTGGATGTAAATATTTCTTGCTG
ATGCTTGAGTGGAGTGTCGGTGTCTAATATTAAGAGTGTT
AACTTGAATACTGGAAAAGTTGAATAAACATGTTGTTTGT
GTTGGTGCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations