header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11079
Transcript Name: slc20a1a-204
Previous Name: slc20a1a-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028597 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028597|OTTDARG00000022254|ZDB-GENE-040426-2217 slc20a1a|OTTDARP00000023382 slc20a1a-004 LG_ CR376723.15 Danio rerio protein_coding KNOWN, 751 bp
GACGGGACTGGATGGAGAAAAGAGGCGCTCGCGGTACGAC
AGCTATAACAGTTACTGTACGGCGGTAGCTGATGGTGAAG
CTGCATTGGAGGATGCGGCTCTGGCGGTGGGGATGGAGGA
TGAGGCACTCAGAGGAGATGTGCTGGAGGAGGATATTGAT
GAGCTGGAGATCGACAAGCCTGAGGTGTCCACACTCTTCC
AGTTCCTTCAGATCCTCACCGCCTGCTTCGGCTCATTCGC
ACATGGGGGGAATGATGTTAGCAATGCGATTGGCCCTCTG
GTGGCCCTTTGGCTGATCTATGACAGCGCCTCAGTGGCAC
CCAGCGCTCCTACACCCATCTGGCTTCTCTTATACGGTGG
AGTGGGCATCTGTACAGGACTCTGGATTTGGGGTCGCAGG
GTTATTCAAACCATGGGCAAAGACCTGACACCCATCACCC
CCTCCAGGTGGGATCAGTGGTGTCTGTTGGCTGGCTCCGC
TCCAGGAAGGCGGTCGATTGGCATCTTTTCCGGAATATTT
TTATCGCTTGGTTTGTGACCGTGCCAATTTCTGGTCTCAT
CAGTGCTGCTATAATGGCACTATTTTATTACGTTATACTG
CCGCTGACCTAATGCGTTACATTAAACAATTTACCCTTTG
TAAATACCTACTTTTTAAACTGACCAGATGCTCGTATAAT
ATGGAGTGCCCTTCAAATTTGTGCCATCAAATGTACTGTA
CATAGCAAATCAAAGACTGTGCGTGGTTGCA

slc20a1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA slc20a1a-002 (1) 586
slc20a1a-003 (1) 898
mRNA slc20a1a-201 (1) 2859
slc20a1a-204 751
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc20a1a-204 Contained in:
OTHER slc20a1a-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028597 (1)
  • Ensembl_Trans:ENSDART00000142528 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD758457 (1) 750bp
    CITATIONS (2)