header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11078
Transcript Name: slc20a1a-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028596 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028596|OTTDARG00000022254|ZDB-GENE-040426-2217 slc20a1a|no_translation slc20a1a-003 LG_ CR376723.15 Danio rerio protein_coding KNOWN, 898 bp
GCTGATCTATGACAGCGCCTCAGTGGCACCCAGCGCTCCT
ACACCCATCTGGCTTCTCTTATACGGTGGAGTGGGCATCT
GTACAGGACTCTGGATTTGGGGTCGCAGGGTTATTCAAAC
CATGGGCAAAGACCTGACACCCATCACCCCCTCCAGTGGG
TTTAGCATTGAGCTCGCCTCTGCTATTACTGTGGTTGTCG
CTTCCAACATCGGACTCCCAGTCAGCACTACTCATTGCAA
GGTGGGTTGTTTATCAGTGAATTAAATACATGCCATTTTA
AAGGCAAAGTAATTCGAGTTTGCTTCTAAGAAGTTTGGTC
ACTTTTTTTCTTCAAGATTTTTACCTGAAATTGTGATCCT
TGTTGATACATAAAGTTCAACATGAGTAATAAAACTAATA
CTCATTTCTTCTGATGATATATTGAGGTGTTATGACGCAA
GACTGACAGTCTCAACAGTTTACAGCATAATTACCTTTGA
AGCAGCCTCAGTAAACAGTCCTTAGTGTGTTAATGACAGT
CTTTAGCGAGAGCTGCCTTTGTTTTGGTGCAATTTGTTTA
AGTTTTCACTTTTTACAGTGTACAAGAATAATCAACAGAC
ATATGAAAAGATTTTTTCATCGTAAATGAAATGTATAGAT
TTTAATTTTACATGTCAATGAGATAATCTATCGTTTATAA
AAGAAATTATTTGACACATTGTTCTATGTATGATATGTTG
AAGCATAAACAAGCAAACAAAAATCATACAATGTAAAACC
CATTAAGTTAAGGTAACTCAAACCATTTGAGGAATCCGAT
TGCAACAAACCATTTAAGTTTTAAAAACTAATTCTAACGA
GTGCTGTGAACTTAGTCCATTTGAGTCCCTTTATTAATCC
AGAGTCGCCACAGCAGAA

slc20a1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA slc20a1a-002 (1) 586
slc20a1a-003 898
mRNA slc20a1a-201 (1) 2859
slc20a1a-204 (1) 751
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc20a1a-003 Contained in:
OTHER slc20a1a-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028596 (1)
  • Ensembl_Trans:ENSDART00000135813 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA470469 (1) 919bp
    CITATIONS (2)