Transcript

suv39h1a-201

ID
ZDB-TSCRIPT-090929-11008
Name
suv39h1a-201
Previous Names
  • suv39h1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028520 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028520|OTTDARG00000022204|ZDB-GENE-040801-111 suv39h1a|OTTDARP00000023316 suv39h1a-001 LG_ BX005340.7 Danio rerio protein_coding KNOWN, 1456 bp
TTGAGAATCATAAACAATCCATCTAGCTTGAAGTGACGAA
GCGAACATGGCGCGAGATCTAAAAGATTGCAGGGTGCCCT
GTAAGCTTTTGTTGGAGGACCTTCAGGCTTTGTGCCGAAG
AAAAAAACTAGTTTGCAAGCAGCTGAGTGTGACAAAGAAC
AACTTTAATGACTATGAAGTGGAGTATCTGTGTAACTACA
AAAAACACAAGGGTCGAGAGTTCTTCCTGGTGAAGTGGAA
AGGCTACGAGGAGTCAGAAAACACCTGGGAGCCTCTTAAA
AACCTTAAATGCCCAATACTGTTACACCAGTTCCGAAAAG
ACATGAAGGCAGCTCTGCTTCAGGCCAACGAACCACTTGA
TTCTGCATCTTTGAGTGGCCCTATCATCTCCTTCCTTCGC
CAAAAGGCCACACAGCGCATTAGGCTTAAAAAATGGGAAG
ACCTCATGAACCAGACCTGCTGGCACAAGGGCCGAATATT
TGTCTCAAATGAGGTAGACATGGATGGACCTCCCAAAAAC
TTCACCTACATTAATGAGAATAAGTTAGGGAAAGGAGTAG
ATATGAATGCAGTAATAGTGGGCTGTGAGTGTGAAGACTG
CGTCTCTCAGCCAGTTGATGGCTGCTGTCCAGGGCTGCTG
AAGTTTCGGAGGGCATATAATGAGAGCAGGCGGGTGAAAG
TGATGCCTGGTGTACCCATTTATGAGTGTAACTCCAAGTG
CCGCTGTGGACCAGACTGTGCCAACAGGGTTGTGCAGAGA
GGTATTCAGTATGACCTGTGCATTTTCAAAACAGACAATG
GCAGAGGCTGGGGCGTGCGGACACTGCAGAGGATTAATAA
AAACAGCTTTGTTATGGAGTATCTTGGAGAGATCATCACC
ACAGATGAAGCTGAGCAGAGAGGAGTGCTGTACGATAAGC
AGGGCGTCACGTACCTGTTTGATCTGGACTATGTGGATGA
TGTCTACACCATTGATGCGGCTCATTACGGAAACATCTCT
CACTTTGTCAACCACAGCTGTGATCCAAACTTGCAGGTGT
ACAATGTTTTTATTGACAACTTGGATGAGAGGCTTCCAAG
AATTGCTTTATTTGCAAAACGAGGGATCAAAGCAGGAGAA
GAGCTCACTTTTGATTACAAGATGACCGTTGATCCAGTAG
ATGCAGAGAGTACAAAAATGGATTTAGACTTCAGTCGAGC
TGGGATTGAAGGATCACCCATCAAGCGGGTCCATATGGAG
TGCAAATGTGGTGTGAGGAACTGCCGGAAATATCTCTTTT
AATTCAGCTTGCACAGAAGAGTTTTGTGTTTGGATAGATT
TCCATGTTCATTTAAACTTTTATTTGTATATACACACTTT
TAGTAGTTTTTAACTTCATGTTGTTATTATTAATTCAGTT
ATTATAAGTTGATCTGTTTTCAGGACTGTTTTAATAAAGT
AATGTTCACCCCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations