Transcript

dgat2-202

ID
ZDB-TSCRIPT-090929-10999
Name
dgat2-202
Previous Names
  • dgat2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028511 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028511|OTTDARG00000022198|ZDB-GENE-050913-15 dgat2|OTTDARP00000023307 CH211-147G3.2-001 LG_ CR293504.11 Danio rerio protein_coding KNOWN, 1593 bp
GCGGCCGACGCCAGTACAGAGAGAGAGATGCTGTAGAGCA
GCTCAACCTTCAGCTCACATTTCTTTACTTTACCTTAATT
TATTCCTCTAGCCTCAACCATGAAGACCATACTTGCTGCA
TATTCCGGTGTCAAAAAGGGCTCGGGCTCCAGCATCCTCT
CTGCCTTACACGACCTGCCCACCGTCCCGTGGCTGACCCG
ATCCAAAATGGTGAAGCATCTGCAGGTGATCTCCGTGCTG
CAGTTTATCATGACATTTCTTACCATGGGCATTGCTTGCT
CTTTGCTGCTGATGTACATGTTTTGCACAGACTTCTGGGT
CATTTCTGTGCTTTACGTTGCCTGGCTTATCTATGACTGG
AACACCCCTGGACAAGACATCTTTATCTCAGGAGGCCGCA
GATCGACCTGGGTGAGAGACTGGACTGTGTGGAAATACAT
GAGAGACTATTTTCCCATAAGACTCATCAAGACGCATAAC
CTGCTTCCCAGCCGAAACTACATTTTTGGCTACCACCCTC
ATGGCATCTTGTGTTTTGGGGCTTTTTGTAACTTCGGGAC
AGAAGCCACAGGATTCACCAAGGTGTTCCCAGGAATCAAG
CCATCTCTGGCCACATTGGCTGGAAACTTTCGCTTGCCCA
TGTTCAGGGAATACCTGATGTGCGGAGGAATCTGCCCAGT
AAACCGAAACTCTATCGACTACCTCCTGTCCAGTAACGGC
ACAGGCAACGCTGTGGTCATCGTGATCGGAGGAGCTGCAG
AATCCCTGGACTGTGCACCAGGAAGAAACTCTGTCATGCT
GAAAAAACGCAAAGGCTTTGTGAAACTGGCTCTAAAGCAA
GGTGCGGATCTGGTGCCAGTTTACTCCTTTGGGGAGAATG
AGGTTTACAAACAGCTGATTTTTGAAGAAGGGTCTTGGTG
GCGTACTATTCAGAGGAAACTTCAGAAGTTTTTAGGCTTT
GCCCCTTGTTTGTTTCATGGCTGTGGACTGTTTTTCCCAG
AGTCCTGGGGTCTGGTGCCTTACTGCAAACCTATCACTAC
AGTTGTTGGTGAACCTATCACTGTGCCAAAGATAGAGGAG
CCGACTCAGGACGTCATAGACATGTACCACGCCATGTACA
TCAGGTCCCTAAAGTCTCTCTTTGACAATTACAAGACCCG
CTTCGGTCTGAATGAGAGCGATACCCTTATCATTCACTGA
GGAATGATGATAACTGTCCAAACGAACACTCTGGAATATC
ATTCAGCCAACGTAAATGCCCATTCAGAGAAGGTGCTGTT
TCTCTTCATTCAATACTGTATATCTACTGAAATCCGCTGC
AGTGATTTCAGCTTACGATACTTCTGCTACTTCTGCTGAT
TTTTGCACAGACTGATGCCAAATATTCACCTTTTTCTTAC
GCCCCATGATGCTTTGCATGAATTATGGGAGGATCTTCTG
CTAAACTGTAAATAATCAGCTATTTTTAAGTATTTTCTTT
TATTTAAACCGTTTACAATGAGGTGTCCTCACATTACACC
CATTAAATAGTAACCTTATTAAACCACTTTCAGCAGACCA
CAAATGACCCCAAAAACTCAACAGTAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations