header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10672
Transcript Name: dnpep-203
Previous Names: dnpep-002, zgc:55944-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028157 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028157|OTTDARG00000021968|ZDB-GENE-040426-852 dnpep|OTTDARP00000023031 DKEYP-78G2.1-002 LG_none CU652701.6,BX323042.7 Danio rerio protein_coding KNOWN, 1009 bp
GAGCGCGATCCTCCTTCTGCTACAAGGCGACAGCAAATCC
ACAGAGCTTCCTGCCTTCTTCATCCCCTGAACTGAATGTG
AAAGTCCACTTTTTATCATTTATGCAGTCTTTCATCATGA
AAAGCTCCAAAGAAGCTGTACAGGCCGCTGCCAAAGAGTT
TCTTAATTTTGTCAATAAAGGAGTTTCACCTTACCATGTG
GTGGAGGAGTGCAAATCTCGCCTGCTGAAGGCTGGTTTTA
CTGAGCTCAAAGAGGCTGAACATTGGGACATTAAACCTGC
CAGTAAGTATTTTGTAACCAGAAATTACTCCACCATTATT
GCCTTTGCTGTTGGTGGTCTCTACAAGCCTGGAAATGGTT
TTTCCATGATCGGAGCTCATACGGACAGTCCGTGTCTGAG
GGTGAAGCCACGCTCTAAGAAGACAAAGTTAGGCTTCTTG
CAAGTAGGAGTGGAGTGTTATGGAGGTGGAATCTGGAACA
CTTGGTTCGATCGTGATCTGACCATTGCAGGACGTGTCAT
GGTGAAGAGCGAAGGCAAGCTGGTGCAGCGTCTGGTCCAC
GTCCCCCGTCCGATTCTCAGGATCCCTCACCTGGCCATTC
ATCTGCAGAGAGACATCAACGACTCTTTTGGACCGAATAA
GGAAAACCACCTTGCACCTTTATTGGCCACGGCCGTACAG
GAGGAGTTAGAAACAGGATCTGCCTCCTCAGGAGATGCCA
GTAATGCAACATGTGTGGCAGAGAAGCATCAACCTGCGCT
CATCCAGATGTTATGTGGACTGCTTTCAGTGGAGTCGAAT
GATTTACTGGACTTTGAGCTCTGTCTGGTGGACACACAGC
CTGGCGCTCTAGGAGGTGCTTATGAGGAATTCATCTTCTC
TCCTCGTCTGGACAACCTGCACAGTTGTTTCTGTGCCCTC
ACGGCTCTCGTGGACTCCAGCACACCTGATTCTCTAGCTA
AAGATCCTAACGTCCGAATGGTTACTCTGTATGATAACGA
AGAGGTGAA

dnpep TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnpep-201 (1)    Ensembl 1726
dnpep-203 1009
dnpep-204 (1)    Ensembl 664
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnpep-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000028157 (1),  Ensembl_Trans:ENSDART00000135974 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EG567216 (1) 958 bp
GenBank:EE313378 (1) 917 bp
GenBank:EG568305 (1) 913 bp
GenBank:BI879208 (1) 651 bp
GenBank:CK697823 (1) 131 bp
CITATIONS (2)