ZFIN ID: ZDB-TSCRIPT-090929-10671
Transcript Name: dnpep-201
Previous Names: dnpep-001, zgc:55944-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028156 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028156|OTTDARG00000021968|ZDB-GENE-040426-852 dnpep|OTTDARP00000023030 DKEYP-78G2.1-001 LG_none CU652701.6,BX323042.7 Danio rerio protein_coding KNOWN, 1726 bp
ATTTATGCAGGTAGGAAAGGTTGTCGAGTAACTTTGTAAG
AGCGCTATTTGTGCAGAGATTTATGTAGTGGTTCTCGTGT
TGAATTTCCGGTTTGCTGCTAGGGTTGTGATTTGTCTTTC
ATCATGAAAAGCTCCAAAGAAGCTGTACAGGCCGCTGCCA
AAGAGTTTCTTAATTTTGTCAATAAAGGAGTTTCACCTTA
CCATGTGGTGGAGGAGTGCAAATCTCGCCTGCTGAAGGCT
GGTTTTACTGAGCTCAAAGAGGCTGAACATTGGGACATTA
AACCTGCCAGTAAGTATTTTGTAACCAGAAATTACTCCAC
CATTATTGCCTTTGCTGTTGGTGGTCTCTACAAGCCTGGA
AATGGTTTTTCCATGATCGGAGCTCATACGGACAGTCCGT
GTCTGAGGGTGAAGCCACGCTCTAAGAAGACAAAGTTAGG
CTTCTTGCAAGTAGGAGTGGAGTGTTATGGAGGTGGAATC
TGGAACACTTGGTTCGATCGTGATCTGACCATTGCAGGAC
GTGTCATGGTGAAGAGCGAAGGCAAGCTGGTGCAGCGTCT
GGTCCACGTCCCCCGTCCGATTCTCAGGATCCCTCACCTG
GCCATTCATCTGCAGAGAGACATCAACGACTCTTTTGGAC
CGAATAAGGAAAACCACCTTGCACCTTTATTGGCCACGGC
CGTACAGGAGGAGTTAGAAACAGGATCTGCCTCCTCAGGA
GATGCCAGTAATGCAACATGTGTGGCAGAGAAGCATCAAC
CTGCGCTCATCCAGATGTTATGTGGACTGCTTTCAGTGGA
GTCGAATGATTTACTGGACTTTGAGCTCTGTCTGGTGGAC
ACACAGCCTGGCGCTCTAGGAGGTGCTTATGAGGAATTCA
TCTTCTCTCCTCGTCTGGACAACCTGCACAGTTGTTTCTG
TGCCCTCACGGCTCTCGTGGACTCCAGCACACCTGATTCT
CTAGCTAAAGATCCTAACGTCCGAATGGTTACTCTGTATG
ATAACGAAGAGGTGGGATCTGAAAGCGCTCAGGGAGCTCA
CTCTAACCTGACAGAGTTGATTCTGCAACGTCTAGCGTCA
AGTCGTGACAATCTGACAGCTTTTCAGGAGGCAGTGCCGC
TGTCCTACATGATCAGCGCGGACATGGCACACGCCGCACA
TCCCAACTACCAGGAGAAACATGAGGAAAACCACAGACCT
GCTTTTCATAAGGGTCCAGTCATAAAGTTTAACAGTAACC
AGCGCTATGCAACCACTGCTGTAACTGCTGCTGTGCTGCG
AGAGATTGCTGGAAAAGTGGGTGTACCTTTACAGGATGTG
ATGGTTAGGAATGACAGTCCATGTGGGACGACAATTGGGC
CAATTTTGGCAGCTCGTTTAGGGATGGCGGTCCTGGATCT
TGGAGCACCACAACTTGCCATGCACTCCATTCGGGAGATG
TGCTGCACTTCTGGAGTCCTTCAAACCACAACCCTCTTCA
AGGGCTTCTTTGAGAACTTCCCCTTTGTACGAAGCACAGT
AACCGTGGACTAGACTGCGAGAGATTCGCCACAACCGCAC
AGATGGGATTCACAGACGTCATTGATAAGGAAATCAACAC
CATATCAGTCATTACCGTCTTTCCATTTGTCTACATTAAT
CCATCATGTCTTGGTTAAGCCTGAAGTTTACACATACACA
CAGACTGTGGCATTTGAACTCTGTTGTTAATAAACAAATA
ATAAGA

dnpep TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnpep-201 1726
dnpep-203 (1)    Ensembl 1009
dnpep-204 (1)    Ensembl 664
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnpep-201 Contained in:
[BAC] CH73-17B14 (1), DKEYP-78G2 (1)

Genome Resources: Vega_Trans:OTTDART00000028156 (1),  Ensembl_Trans:ENSDART00000009382 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC044551 (1) 1721 bp
GenBank:CN024709 (1) 948 bp
GenBank:CO927049 (1) 832 bp
GenBank:CV488351 (1) 804 bp
CITATIONS (2)