ZFIN ID: ZDB-TSCRIPT-090929-10661
Transcript Name: ttc26-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028139 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028139|OTTDARG00000021957|ZDB-GENE-041212-41 ttc26|no_translation CH211-146L13.2-003 LG_ AL954384.11 Danio rerio protein_coding KNOWN, 844 bp
GAAAATGAATGAATTAATGAATTAATTAATTACATTTTTA
GTAGCATAAAACATTAAATATCATAATTATTTTGAAACAC
TATCAGTCTATTACTTTCTGTTGCAAAGAAAATCAAGGCA
ATCTGTTATTAGTAGTTTGACTGTCAATTGTTCAGACCAC
TGCCACATTTCGGTAGTTTCTACAGCTCTGATCCTGCTTG
TTTTGTTCCCTCAAAATTGTATTTTGAATTAGAATATTTC
AGCGATTATTTAATAAACAGTTGCTTTAGATATGTTATTA
AAATCAGTTTTGTGATCTTTTTTTCAGATGGGGCAGTTCT
ATTATGCAGCTAAAGCATTCGATGCTCTGGAGAGACTGGA
TCCAAACCCTGAGTACTGGGAGGGGAAGCGTGGAGCTTGT
GTCGGCATCTTCCAACTCATACTCGCAGGCCGAGAGTCTA
GAGAAATACTGAAAGAGGTTTTGCCGATGTTGAGGAGCAC
TGGTAACCCACAGGTTGAGTACATCATCCGCATCATGAAG
AAATGGGCCAAAGACAACAGAGTGGCTCTCTGATTGACTA
CATCGACTAGCATACCCAAACTGATTCTTCTGTAAATGAT
ATTTAAAAACGCTTTTGTATCTTATCTGTATGATTGCTTG
TTTGTATCAACAAAATATGTGGTGAGTAAAACTGTTCAGA
CTCAGAGAAACGTATACCTGTGGCCTGACTATATTTCTTA
TATTGTATTGTATATTTTTCGAATACTTGCGGTTGTCATA
AACAGAAAACTCTGCATTTACAATATTTCTCTGTGTGAAT
GTTTTCTGTCAGAGTGACAGCGTAACAAATAAAGTTTTTA
TCTT

ttc26 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ttc26-001 (1) 2427
ncRNA ttc26-002 (1) 301
ttc26-003 844
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ttc26-003 Contained in:
OTHER ttc26-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028139 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT629771 (1) 773bp
    GenBank:CT629772 (1) 685bp
    CITATIONS (1)