header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10659
Transcript Name: ttc26-201
Previous Name: ttc26-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028137 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028137|OTTDARG00000021957|ZDB-GENE-041212-41 ttc26|OTTDARP00000023016 CH211-146L13.2-001 LG_ AL954384.11 Danio rerio protein_coding KNOWN, 2427 bp
TTCTGGATCTGCCTCAATAGTGAAGGACGGGTCGCTAAGC
AACAGCTTGATGCCGCGCCACAAGCAAACATGGCAGACAA
GATTAGCTAAGAAAAGCATCTTACACAATACGACGAGCGC
AGTAACAGATTACACATATTCATATGTAGTCTGATTTAAT
AATCAGGATCTAGAATCAAGCGAATTGTTCAAAGGCGAAC
GCAGATCTGCTTCACTTCTGCGTGCACGTAATAGTTGCTT
AGCAAGTTTGCTAGCTTGTAGGCTAACGTTATCTGGCTAA
CGTTAGTTCACTTCATTCACAGATTTACACTTCTAACGTT
AGATGTATTGACGTATAAGTCAAATCAGCTTGTTGATTTC
GTTTTTGGTTTTATCCGCTTTATGATGTTTAGACGGTTAG
TAAAATGACTGATTAGGTTCATGACTGAGGTGTTTGAAGA
AAGAGAACAGTCGTCACCATGCTCTTGTCTCGGATGAAGC
CAGCAGTGGGTGGTGAGGCCTCCACCAGTTCTAATGAAAA
GAAAAGGAAGAATAAAAGCAAAAAGATCCCAAGGCTTGAG
GATTATCTAAACCAAAGAGACTACCTGGGTGCCCTTACTC
TATTAGAGTTCCAGCGTAATAGCGGGGTCTCAGTGGAGCA
CGCAGATCTTTGGACTGGTTTCTGTGCCTTTCATGTAGGA
GACCACAAGAGAGCAATGGAGGAGTACAAGGCCCTCACTT
TGAGGCCGGATTGTCCAGTGGATGTTTGGGTATATCTGGG
CTGCGCACTGTTTTTCCTTGGGCTTTATAAAGAGGCCGAG
GAGGCAGCACTGAAAGGGTCGAAAACTCAGCTTCAGAATC
GCCTGCTCTTTCATTTAGCTCATAAGTTCAATGATGAAAA
GAAGCTGATGGGTTTCCATCAGAACCTGGAGGATGTGACA
GAGGATCAGCTGAGCTTGGCTTCCATCCACTACATGCGCT
CTCATTACCAGGAGGCCATAGACATCTACAAACGGATCTT
ACTGCAGAACAGAGAATTTCTGGCCCTGAATGTGTATGTG
GCTCTGTGCTACTATAAGCTGGATTACTATGACGTGTCTC
AGGAGGTGCTGGCTGTGTATTTGCAGAGTATTCCTGACTC
TACTATCGCCCTCAACCTCAAAGCCTGCAACCACTTCAGA
CTCTATAATGGCAAAGCTGCTGAGACGGAGTTGAAGAACC
TGATCGACATCTCCTCCAGCTCGTTTCAGTTTGCTAAAGA
GCTGATCCAGCACAATCTGGTGGTGTTTCGCGGGGGTGAA
GGGGCCCTGCAGGTTTTACCTCCTCTGATTGACGTCATAT
CTGAGGCCAGACTCAACCTGGTCATCTATTATCTCCGACA
AGATGACATTCAGGAGGCCTACAAACTAATCAAAGACCTT
GAGCCCACCACGCCTCAGGAATATATCCTGAAAGGGGTGG
TTAATGCTGCTTTGGGACAAGAAATCGGATCGAGGGACCA
TTTGAAAATTGCCCAGCAGTTTTTCCAGTTGGTTGGAGGC
TCAGCTAGTGAATGCGACACAATACCAGGCAGGCAGTGCA
TGGCCTCTTGCTTCTTCCTGCTGAAACAGTTTGAGGATGT
GCTCATCTACCTCAACTCAGTCAAGAGTTACTTCTACAAT
GATGACACGTTTAGCTTTAACTACGCTCAGGCCAAGGCGG
CTCTCGGGAACTACAGAGAAGCTGAAGAGCTGTTCCTGCT
CATCCAGAATGAGAAGATCAAGAGCGATTATGTTTTCCAG
AGCTGGTTAGCGCGCTGCTACATCATGAATCAGAAGCCTC
GACAGGCCTGGGAGCTTTATCTGAGAATGGAAACCTCATC
CGACCCCTTCAGCCTCCTGCAGCTCATCGCTAATGACTGC
TACAAGATGGGGCAGTTCTATTATGCAGCTAAAGCATTCG
ATGCTCTGGAGAGACTGGATCCAAACCCTGAGTACTGGGA
GGGGAAGCGTGGAGCTTGTGTCGGCATCTTCCAACTCATA
CTCGCAGGCCGAGAGTCTAGAGAAATACTGAAAGAGGTTT
TGCCGATGTTGAGGAGCACTGGTAACCCACAGGTTGAGTA
CATCATCCGCATCATGAAGAAATGGGCCAAAGACAACAGA
GTGGCTCTCTGATTGACTACATCGACTAGCATACCCAAAC
TGATTCTTCTGTAAATGATATTTAAAAACGCTTTTGTATC
TTATCTGTATGATTGCTTGTTTGTATCAACAAAATATGTG
GTGAGTAAAACTGTTCAGACTCAGAGAAACGTATACCTGT
GGCCTGACTATATTTCTTATATTGTATTGTATATTTTTCG
AATACTTGCGGTTGTCATAAACAGAAAACTCTGCATTTAC
AATATTTCTCTGTGTGAATGTTTTCTGTCAGAGTGACAGC
GTAACAAATAAAGTTTTTATCTTTTGA

ttc26 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ttc26-002 (1) 301
ttc26-003 (1) 844
mRNA ttc26-201 2427
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ttc26-201 Contained in:

OTHER ttc26-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028137 (1)
  • Ensembl_Trans:ENSDART00000032494 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC086810 (1) 2410 bp
    GenBank:EG585039 (1) 902 bp
    GenBank:EG575229 (1) 864 bp
    GenBank:CK681114 (1) 751 bp
    GenBank:CN179193 (1) 748 bp
    GenBank:DY559560 (1) 699 bp
    GenBank:BQ284892 (1) 680 bp
    GenBank:BI673618 (1) 619 bp
    GenBank:BQ074280 (1) 560 bp
    GenBank:CT696491 (1) 526 bp
    CITATIONS (2)