Transcript

casp9-002

ID
ZDB-TSCRIPT-090929-10612
Name
casp9-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028082 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028082|OTTDARG00000021922|ZDB-GENE-030825-5 casp9|no_translation DKEY-7I1.2-002 LG_ CR376748.8 Danio rerio protein_coding KNOWN, 658 bp
ATGGACTCCAAACATCAGTGGAACCATTTAAACAACCCAA
GACTTTATTTTAATTGAATGTTTTCCATGTTGATTGCTAT
TTTTCAAACTATGGAACTGTCTATTGTTTGCTCCTGTAGG
TGAGAAGGATATTGGTTTTGAGGTTTCTCCAGATGACGTT
CAACCATCTATAGGTGGGATAGATGACGAGATGGACGCTA
TTCCCATGTCCTCTAGCAGTGACTCTCTCAGCACAGCGTC
TGATGAACTTGATGCACGGGCAAGTTTGCCCACGCCCAGT
GACATCCTGGTGTCCTACTCAACATTTCCAGGTTATGTCT
CCTGGAGGGACACAGAGGCCGGCTCTTGGTATGTGGAGAA
TCTTGATCGTGTGCTGGAGGAAAACGCTATCACAGATGAT
CTGGTGACCATGCTGATGTTGGTACGTCTTTGTCCTGTAA
ATCTTCTGAAGTTTGATTTATGTGATGGAAACTGCCACAT
ATAGATGCATTATACAGTATATGCATCAATAATGATTAGA
GCAATGTGTATATATTCTATACAGCTTTATACAATTATAA
ATAACTATGTAGCTTATTATTAATTGTGTAATTTTTCAAT
CTTACCTTGAGGTTTAAAGTCTGTGTGTATGAAAACAAAA
AAACATTTATATTTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations