Transcript

lrp11-201

ID
ZDB-TSCRIPT-090929-1061
Name
lrp11-201
Previous Names
  • lrp11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007855 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007855|OTTDARG00000006985|ZDB-GENE-030131-7847 lrp11|OTTDARP00000006951 lrp11-001 LG_ BX248418.16 Danio rerio protein_coding KNOWN, 1883 bp
ATCTTTTGTTTGTTTTTAGGACAACAATATCTCCAGCAGA
AAAGATGCGGTTTTATATTAAATTTAAACCAATGCAAATC
GCAAATCATGTGATATTTCCCTCAGAGGAAGAAGGTACAG
TCTACAGTCAAAACAAACCCATCTTTTTCATAGAAATAAA
TCTAAATTAAGATGCTGAAATCATAAAATATCTATGCAAA
AAAAAAAATAAAAATCAAGATGTGAAATAAAATGATCTCT
AATATCAGAGTTATAAATGTGCGTATTCGTGCTTTGTGCT
GTCTGGTCTTTCTGGACCCCAGAGTGTCCCCTACAGGAGA
GATTGAACACGGCAGACTGAAGCTGGATCAGTCGCTGCGG
CTGCTTCAGTTCTGGCGCTGGACTCGACAGGTGCAGCTTC
AGCTTCATCCTCCTCTTCAACAATGCGCAAAACGGCGATT
CTTACATCCTAATCTAACGATCGGGATCGCAAATGTGATG
TGATTCTTTCCACGGTGGGAAAGTAGTGTTTAATCCCATC
ATCTTCATCCTTGTTCTCCTCATCATCATGTTTCCGCGGG
CGCATCATGTTCTGCTGTGCGCAGCTCTGCTCTGGGTCTC
CAGCTCGGCCGGGGCGCGCTCCTCTCCAACATCCGAGCTC
AAATCCCGGATCTCCGGCGTGGAGGAGCTGCTGGAGGAGT
TCCGCAAACAGCTGCAGCAAGACGAGCCAAGCTCCCGGGA
GCAGGAGGGGGATGGAGACCGCTGCGTCGCGGGTTTCAGG
GCGGCGGAGTCGCGCATCATCCGCGCCAGCGCGTCCATCG
AGCAGGGCGCCGCGTTCCTGTCCGCGCCGCCGCGCGTGTT
CAGCTGGAGGGACTGCGCGCGCGCCTGCTGCTCGCTCCCG
CACTGTACAGTCGCCATCATCCAGGAGGACCTCAAGCAGC
CTGACGACAGTTTGCGCTGCTATTTGTTCAACTGCACCTA
CAGGGGCAAGAGCGTGTGCTCGTTCTCCTACCAGCCGGGA
TTCAGCACCTACAGCCGCTTGAACGACAGCTCCGGGGCCC
CGGGCACTGCTGCCACCGACCGGCCGGCCGGGAGACCCGC
ACCTGCGCTCGGCGAGGAGGAGGCCATGATGCAGGATCTG
GACGAGCCGCCCCGCAGTGACGCTGGTCAAGATCTAGTGG
TGCAGCTGCCGACGGACTGGGCAGTGCTGGACGGCAGAGA
CAGTACCGATGATCACCACATCACCCGCTATGAGTGGGCT
CTCGTCAGAGGAGACCCTTCTGTTAAAATGAAGGTAACTC
ACCCGGGCCTGCTGAAGCTCAGTGGACTCAGAGAAGGAGT
TTACACCTTCGAGATCACGGTCATCGACACGGCGGGACAG
AAGAGCTCAGACAACGTGTCCGTCAGCGTGCTCGCCCCGG
CCCCAAACGCACAGGTTTGCACAGGTCACTGTTCTCGCTA
TCAGTTCATGTGTGATGATGGCTGCTGTATCGACATTGGT
TACGCCTGCGATGGAAAGCAGCACTGCCCTGACCGCTCAG
ATGAGGACTTCTGCCAGAACTTTGATAGTGGTCGTAAGTC
CAGTTCCTCAAAACATGGAGCAGATCTACAGACTGAAGCT
GCAGCACAGACCCCCACAGAGATGCAGCACACCGATATCT
CCAAACCTGAAGCACACCAACATTACGGCTTCAGTAATCA
AGGTGCGATCCTGCCGCTGGCCTTCGGTCTGCTCATCAGC
GCTCTGCTCTTGCTGATGGTGGGCTGCCGGCTCTTCCTCG
TGCGCCGCAGGCTGAAGAAAGCTCTGCCTCTGACCACAGA
AGAGTCCGACTACCTCATCAACGGCATGTATCTGTAGCAG
CGCAGACCAAAGCCAGCCTCCAGTCTGCTGAGTGTGTGTG
TAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations