Transcript

foxo3b-201

ID
ZDB-TSCRIPT-090929-1050
Name
foxo3b-201
Previous Names
  • foxo3b-001
  • foxo5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007800 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007800|OTTDARG00000006940|ZDB-GENE-990708-6 foxo3b|OTTDARP00000006899 foxo5-001 LG_none CR352296.12,BX927123.8 Danio rerio protein_coding KNOWN, 4540 bp
TCTAAGTTGAGCTCGCTAGAGCGCTGACAGACGATTAGAC
CAGAAAGTCCTCTTGTGCCTATAGATAGATAGATAGATAG
GTGAAGAAGCTTTCTGGAGGGGATTTTTTTCCTCAATGTA
CCGTCCGTGACATCGGCATCGGCGCGCGCTCTAACTAGCA
GCCACTGACAATGCGCGACAGATGCGTCTTTACCTTTAAC
TGTTAAAGAGATTTCGGAAAGCGAAGAGACATTGAGTTAA
TCTGGGAATTAATACAGATATGATCACTGCAGCTAACGAG
CACGCGTAGCTCTGTCCTGGTTATAGTAGTTGTCCTGATC
TGATTTTGGCTGAATAGCTCGTTGAACGCGCTGCGGCTCT
GACAGGTCAGTTCTTTTGTCACTACAGTGAGTTACTGCTG
GTGATGCTTGTGTGCAGTGACGTTGTGGCGCTTTGTCCAA
GGTGCGCTGGAGAGATATAGTTGAATTACATCAGTGCACC
AAGTGACTGGAGTGCGACACAGAGAGGAGACACGGCGCTG
GATGAATGGGAGGAGAGGTGTTAATTCCTAATAAGATTTG
CACTAGTTGAAGCGTTAAGCATCATTTAGAGTAGAGGTGC
ATTCATGGAATGCGAATGTGACCGCATCCCACTGCCTATC
TAACTTCGACCAAGACAGTAAAGAGGAGTGACAGAAAAGA
CTTTTAGGAAAGATGGCAGAGACAACCCTGGAGCCACTGT
CCTCTCTGGACATTGCCATTGATCCAGATTTTGAGCCACA
GAAACGGCCGAGATCATGCACTTGGCCTCTGCCCGAGTCC
AGCATGGCTAAGCCTGCATCCAATGACACTGATATAATCC
CAGAGGAAGAGGATGATGAGGATGACAGCGCGATGACAAT
CAATGCCAATGGCATGGGTGAAGGAGAGGACAACGGCAGC
CCAAGCCTGGCCGAAGAACTAATTTCCATTAACGGCCAGG
AGAACACAGGCTCTCCACTCTCTTCTCAGGCAGCTTCCGC
AACCACAGCGAGTCCAGAGGTGGCCAGTCAACAGCAAACT
CCCAGGAAGTCATCTTCAAGGAGGAATGCATGGGGCAACC
TGTCCTACGCCGACCTGATCACCAAAGCCATAGAGAGCAC
CCCTGACAAGAGACTCACACTGTCCCAGATCTATGACTGG
ATGGTCAGCAGTGTCCCCTACTTCAAAGACAAAGGCGACA
GCAACAGTTCAGCTGGTTGGAAGAACTCCATCCGGCATAA
CCTGTCCCTGCATAGCCGTTTTATCCGTGTACAGAATGAA
GGAACTGGAAAGAGCTCGTGGTGGATGATCAATCCTGAAG
GGGGGCGGGGAGGTAAAGCGCCAAGGCGACGTGCAGTCTC
CATGGACAATGGTAACAAATACACCAAGACTGCACGTGGG
CGTGCGGCCAAGAAAAAGGCAGCGCTGCAGGCTGCCCAGG
AGGGTTCACTGGAGAACATATCTGCTGGTGGCCTGTCCAA
GTGGCCAGGAAGCCCCACTTCCCGGAGCAGTGATGAACAG
GAATCGTGCTGGACTGACTTCCGTTCTCGAACCAACTCCA
ATGCTAGCACCGTGAGTGGACGCCTGTCACCTATCCTGGC
CAATCCAGAGCTTGATGATGTCTCAGACGGGCCACCCCTG
TCTCCAATTCTTTACTCCAGCCCCAGCAGCCTCTCTCCTC
CATCGTCAACCTCATCAAACTCCAAAACGTGCCCGGGTGA
ACTCCCAGTACTTGCTGACCTGACTGGCACAATGAATCTT
AATGAGGCGGACAACCTAATGGTCGATTTGTTAGACAACA
TCGCCACACAGGTGCAGGTAGTTCAAGAATCCTCTCCTTT
CAGTTTTGGCTCTAAGAGCACTGCGTCACCCCCAAGCACC
TCTACATCTCAAACTGTGAGCAACAACACTGGAGGATTCA
GCAACCCCATTTTTGGCCCTTCGCCGGGAAGCCTCCGTCA
GAAACCCATGCAGACCATTCAGGAAAACAAGCAAACATCG
TTCTCCAGCATTTCTTGTTTTGAGACCTCACTTCAGGACC
TGCTGAATTCTGATTCGCTGGTCTCTCACAGTCATAGTGA
TGTAATGATGACGCAGTCAGACCCACTTATATCACAGGCC
AGTGCTGCAGTCACCTCTCAAAACTACCGTCTACGCAATA
ATCCTATGCTTCGTAATGATCCCATGATGTCTTCATTCAG
TTCTGTGCTCAATGGGCGAAGCGGGCACCTACAGAACAAG
CAACACCATCAGGGGTCTAATGGCCAGGGATCTTTGCGTT
CCCTCTCCAACAACAGAGCGCAAAGTTTAGTTAACGATGC
CAATAATCTAGTCTCAGCAAAGCAGCTCCTCCAGCCACAG
CCCACCATGCTGATGACCGAGACGCCGCTTTACACTGGCA
TGAATGGAAGTAATGGGCTTGGAATCTGTCACCCTTCAGG
AACAGATCGATTTCCCTCAGACTTGGACCTTGACATCTTT
AACGGCAGTCTGGATTGTGACGTGGATTCCATAATCCGCT
CAGAACTAATGGACTCCGATGGACTGGATTTTAACTTTGA
TGCTTTAATGCAAAATGCTGTTAGTCTGAATCCTGTGGGA
AACTTCACTGGAACAAAGCAGTCCAATCATAGTTGGGTGC
CAGGCTGATGGGAATTGCTCAGGCTCAGCTCATCAAAGAA
AACAACAAATAACCGAATAACAACTACAAAAAATCCTGCA
CAAAAAATAAACAAACATCCAACAGACTTGAAGTATCCTT
TGCCAAGTTTGCTGTCTGCGGCAAGCACTGGATGATATGC
CTGTTTACAGGTCCATCTGACTACAACATCCCTGATGATG
TTTACCTTCAGTTCAGCAGACCCAGACTATAACGAAAGAC
TGCCCAGTGGAAGAAACACTCAAACTAACAGTGAACTCAG
ATTATTAATGCCACATTATGCAATGTTTGAAATGATCCCT
TTTGTTAGAGGTGAAGTAATCTGAAAATTTCGTTTAAAGA
GGCCTGTTGTAGCTTTTCTGTCATAAACATACAGTAGTTT
CCATGGCTGGGGTCTCTCTCTCTCTCTCTGTTTTTCCTAA
CTTTATTTGTTAAATGATCGGCTACTTGTGTCACTCTCTA
AGCACTAACTCTGTAGTCACTGATCAACATAAGAAGCGAA
GAGTTAACCTGAAAAATTTCAGAGCTCAGGTGGAGTAATG
TAGCTTGACACAGTGCACTTCATTCAATGCTTTCATTTTT
AATTCACTGTTACCATAAAGTAGTTAGTTCCCAATCTGAA
TTATAGTTGCCTCATAATAATAATGAAGTAATGCATTTTT
TGTGATTGAATATAATCATATAAGGAGTAATTCATTTGTG
TTTACTGTCTGTAACTGTACAAAAAAGTGGTAAAACTGAA
AGCTTATAGCAGGTGGAGGCGTCTTATTTAGCCAGCAAAG
CTATGTTCGGACTTCTCACATTTAAATGTAGCCAAATGTA
ATGAATAAATAAATATTAACTTGCATCGTGGACATTTCCA
TGCCATACCAGGTGCTAAATGATCAGTGTTGAGCCCTGTC
CTTTATTAAAGGCCATTTGTGTTTCCCTGGCCACGAGGAC
TAGCATAATCGATTAGCATTAGCAATTAGCATCATGGCAG
CATTCAATGGTGGATGAGCCTTTCCTCTGAAAGCCATCTT
TACTGAGCAAAAACAATAAGCTATCTTTTGTATATTTGCC
AAATTACTTGAAAACGTATAGGAGATGCTGGCAGCCAAAA
TCACAAACACACAGTGAAATCCGGGGACATTTGGGTCTCC
GTATGCAAAATGCATCACTATTGCTCAGGGGAGAGTGGGG
TCTCCATTTTAAAACATCAGGGCCTCATCTTGAATTAACT
GCAACCTGGCTGTATGCGATTTCAGAAATGTTTTATGAAC
ATACGTACATGAACAACAGTCTTCTAAAGTAAGGAGATAA
AGCAACAGGAATCCATCCTGTGTTGTTGTCAGTTTATTGA
TGTCTTCATGGGGGTTGTCACTTTATTAAACTTCTTTCTG
TTTGTTCCATTGTGCTCAACTGTTACCACAAAATATGTAC
AAATCCTGATGTTTTGTGTTTCCGTCTCTCAGAGAGAGCT
ACCGTTCACTGCATACAGTACGTCCATCTTTGTATGCATG
CATGTAAATGTACATATGCATCGTGTGCAATGCATATATA
TGTATACATACAGCTATACTTATGAAATGTAGTGATAATA
CAACTGTATCTTTCAAAGGCCATGCACATGAACAAAATAG
TGGAATTGTTACATGGGGAGTTGGACATGGTTTATAGCAG
AAGTGTCAAAATCTATGTTTACCATACTTTTAGTCTGCTT
TAATAGCTAATAATGTGCTAATAGTAGAGTCTTTCAAGCC
CCAGTTTGCTGCAGATTTGGTAATTAGTAGGGATGTCCTG
ATCAGTTTTTTTTTCTCCTGGAGTCATTTGATTTTAAGTA
TCTACTGATACCGAAACCTGATCCGCTACTTCTATAATAC
TTAAAAAAAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations