Community Action Needed: Please respond to the NIH RFI
Transcript

bmp2b-201

ID
ZDB-TSCRIPT-090929-1034
Name
bmp2b-201
Previous Names
  • bmp2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007759 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007759|OTTDARG00000006906|ZDB-GENE-980526-474 bmp2b|OTTDARP00000006864 bmp2b-001 LG_ AL929237.18 Danio rerio protein_coding KNOWN, 1961 bp
GCGTGCTGCACGCAGAGATGAGTCTCCAAACAGCCACGGA
AAACTTCTGCTGACCACAAGTTTTCGATTTCTTTAAAACA
AAAACAAAAAATGACAAATCCAGGATTGTGCGATCTCGCG
CTGTCACTTTTGGGATTGCTGCTGTCTTTGACCTGAGCGC
TCGCGCACTTCATTAGAGTTTAGTAGAGTCTAGTCTGAAG
TGTTGCACAAGTATGAACAAGAAGAGGCGACTTGAGCTGC
GACGACTCTCTGTCGTGGGATAAAAAAATCGCTTGTGGAT
TAAAACACGAATTCATGAGGAACTTAGGAGACGACGGGAA
CGCAGACCGGCCACAGCGCTTCCTCCTCCGGAACTGACTG
ATCATGGTCGCCGTGGTCCGTGCTCTCACGGTGCTGTTGC
TCGGTCAGGTGTTGCTGGGAGGTGCCGTTGGACTCATTCC
CGAGATCGACCGACGGAAATACAGTGATTCGGGGAGACAC
ACACCGGAGCGAACTGATACAAACTTCCTGAACGAGTTTG
AGCTACGCTTGCTCAATATGTTCGGATTGAAGCGAAAACC
CACCCCAAGCAAATCGGCAGTGGTCCCTCAGTACATGCTG
GACTTGTATTATATGCACTCTGAAAACGATGACCCGAACA
TTCGGCGCCCGAGGAGCACTATGGGAAAACATGTAGAAAG
GGCAGCCAGCAGAGCAAACACGATACGAAGTTTTCATCAC
GAAGAGGCTTTCGAGGCACTGTCCAGCCTGAAAGGAAAAA
CAACGCAGCAGTTTTTCTTCAACCTTACCTCCATTCCTGG
CGAGGAGCTGATCTCCGCTGCGGAGCTGCGCATTTTCAGG
GACCAAGTTCTCGGAGATGCCAGTACGAGTGGCTTCCACA
GAATTAACATTTACGAGGTGTTCAGGCCAGCTTTGGCCCC
CTCCAAAGAGCCTCTAACCAGACTTCTGGACACCCGTCTG
GTGCAGGACTCTCACACGCGCTGGGAAAGCTTCGACGTGG
GTTCAGCTGTGGCACGCTGGGCCCGCGAATCCCAGCACAA
CCATGGGCTCCTTGTAGAGGTGCTCCATCCTAAGGAGTCA
GAAGTATCCGAGGAGGCTGAGAGCAACCGGAGGAAGCACG
TGAGGGTCAGTCGTTCCCTTCACGCGGATGAGGACTCGTG
GGCACAAGCCCGACCTCTGCTGGTAACCTACAGCCATGAC
GGTCAAGGCACAGCCGTCTTGCATTCGAACCGAGAAAAGC
GGCAGGCTCGACGAGGGCAAAAGCCGAGGAGAAAGCACCA
CCAGCGCTCGAACTGTAGGCGACATGCTCTCTATGTGGAC
TTCAGTGATGTCGGCTGGAACGAGTGGATCGTGGCACCGC
CAGGCTATCATGCTTTCTACTGCCATGGCGAGTGTCCGTT
CCCTCTGCCGGACCATCTAAACTCCACCAACCATGCCATT
GTCCAGACGCTGGTGAACTCGGTCAACTCCAACATTCCCA
AAGCCTGTTGCATCCCGACGGAGCTCAGCCCTATCTCACT
GCTGTACCTGGACGAGTACGAGAAGGTCATTCTTAAAAAC
TACCAGGACATGGTGGTGGAGGGCTGCGGTTGCCGATGAG
AACAATCTCCCCAATGAAGACTTTTATTTATACAAAAGAG
CGAGCTATTTTGGAGGAAGAAAAGAAATATATATGAATAT
ATTTATGTTGAATGAACAAAACAAAAAAAATGGGAAAATA
AATATTTTAATGAGAGTGCTTGCTTTTTCCAGTGGCTTCG
AAGATGATTTTTTTTCTTGCCCCATTCCAAAACAAGTGCA
ATGGCACATGAAGTATAATGCTCAGATTTTTATGATGTAT
TTATTGCATAACCACTTTATTTGTAAATGTGTATTTATCA
TGAAAAAATATATGATCTTCATTCAGTGTGCATTTGGGAA
TACCTTATTTGATACCAAAAAAATAAACAATGGATGATGA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations