Transcript

irs2a-201

ID
ZDB-TSCRIPT-090929-10322
Name
irs2a-201
Previous Names
  • irs2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027779 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027779|OTTDARG00000021742|ZDB-GENE-040426-975 irs2a|OTTDARP00000022740 CH211-198K9.2-001 LG_ BX908780.7 Danio rerio protein_coding KNOWN, 4190 bp
AGCTCACTCGGCCACTCCGAACGAGGAGTTGCTAGTGGAG
AACTACAGACATTACGCGCTGAAATCTCCAGAAATCGGTT
AAGTTTTTCTTGTTTTTTTTTTTTTAACGAATGGATAAGT
TTTGGAAACTGAGTAAATAAACTGTCAACGCAAGTATGGC
AAGTCCGCCTCTTAAAGGGGGACCCTCGCTATCAAACAGC
AACAACATTCATTCAAACAACATACGAAAACATGGATATC
TCAAGAAGCAAAAACACGGACATCGGCGCTATTTTGTTTT
GAAAGACACGAGCGACGGACTCCCAGCGCGCTTGGAATAC
CACGAGAATGAAAAGAAATGGAAAAACAAGTCTGCTCCAA
AAAGAGTGATATTCCTCGACTCGTGTTTGAGCATAAACAA
GCGCGCTGACGCGAAACACAGATATTTGATAGCCCTCTAT
ACCAAGGACGAATATTTTGCTGTGGCTGCGGAGAATGAGC
AAGAGCAGGAGAGCTGGTACGGAGACTTGGCTGATTTATT
AAGCAAAGGAAAAGTGTGTGACAGCACCGTTTCTAATTCG
GCATCCTCTCTGGTAGGCTTCGACGAGGGAAATTACGGAA
TGATTACACCGGTGAATGCTGCTTATAAAGAGGTATGGCA
AGTGAACCTTAAAGCAAAGGGACTTGGGCAGAGCAGAAAT
ATCACTGGAGTTTTTAGGCTGTGTTTAACAAGTCGGACTA
TTAGTTTTGTGAAACTTAACTCCGAGGTGGCATCAGTTAC
CCTACAGTTGATGAATATTCGTAGGTGTGGGCACTCTGAT
AGCTTTTTCTTTATTGAAGTTGGAAGATCAGCCTCTACTG
GACCTGGAGAACTGTGGATGCAAGCAGACGATTCTGTGGT
GGCACAAAATATACATGAGACAATTTTAGAAGCTATGAAA
GCAATGAAAGAGCTGTCAGAGTTCAGACCCCGCAGCAAAA
GTCAGTCATCAGGATCAAACCCCATTTCTGTACCCACTCG
TCGGAACCTAAACAATTTACCTCCAAGTCAAACAGGGCTA
GTGAGGAGGTCAAGGACGGACAGTACAGCAGCCACATCTC
CCGTGACCAAATTTTCTTCTTGTCGAATACGGACTGCAAG
TGAAGGGGAAGGTACCATGATCAGGCCAGTCTCTGTATCA
GTATCTGAGAATGGAAGCCCAATGACTGTTGGCCGGCACC
ACATGAGTAGATCTAATACTGTTTCAGTAGGCTGTCGGAC
ATCAGAACCATCACTACTTAATCACAGCAGGTCCATGTCT
ATGACCATGTACCACTCTCCCCCATCTGTTGTAAGTCCAC
TAAGTTTGTCTTCAATCAGTATGAATGGTTCTATCTCAAA
CAAAGCACACAGACCTTCCAGCTGTAGTGGTTCTGTTTCT
GGGTCACCAAATGATTTTGGCTTTTTAACGTGTGAGGATT
ACAGTTCCAGCCCAGGGGATGTGAGGTACAACCTAGCAAA
CAGGAGTGACACTCCTTCTTCTCTGTCCAGCACACCACCC
TTACGAGAAACCAGTGAACTCCATAGTTATATGGTGATGG
ACAGGCCATCCAACTTTTCACAGAACAAGACTAGCAGAGA
CATGTTGGATGTGGAGACATACAGGAAGAGGACATATTCT
CTAACAACCCCACGGCAACAGATGGCACACTCCCAGTTAT
CTTCAGCGTCACTTGATGAATACATGTTGATGAGGGCTGC
GAACAGCCACTCTGGACGGAGCACAAATTCTGCTTCTCCT
AAACTTTCATATCCAGAAGATTATGGGGACATTGAGATAG
GCTCTAACTGTAATGTGGGTGATGATGGCTACATGCCAAT
GACACCAGGCATGGCACCTCAGAGTGCAAAAAATGACCAC
TACATGCCAATGAGTCCCATGAGTGTTTCAGCACCCAAGC
AGATCATTAACCCGAGATCTCATCCACAGTCTCCAGGCAG
TGGCTGCACAGCTAACTCCCCCAGCAGTGGATCTCTAGAG
GACAGCGGGTACATGAAAATGTGGTCCGGATCCAAGTTTT
CACTGGAGAGCTCAGATGGAAAAGCAGCGAATGGAGAATA
TGTGAATATGTCACCTGTTGACACATCCATCTCACCCACA
CCACCAGAATATTTTATGGGTCCTTGTGAGCCAACACAAC
GGCCCTCCCCAACTCAAAGTATTCGCTTCAATAAGCAACA
GGTGCCTAAAAGAGTAGATGATAACCAGTATGTTTTCATG
AGTCCTCAGAACCAAAATCAAACCGAAGAGGCCAACAGCG
TTTCTTCTCTGCCCCCTCTCTATCGCCCTGATGTAATGGC
ACAGAGATCAAAGGTCAACAGGCCCAATAGGTTATCTCTA
GACGCTCTAAGGATGCTTCCAAGGATGACTGAACATCCGC
TACCATGTGAGCCTAAAAGCCCTGGAGAGTACATAAACAT
AGACTTTGCTGCTGCTACTCAGTACTCCTCTCAATCTATG
GTCACTGTGGAAAATCAGGCCTCACTGTCCAGCCTCAGAC
AGGGATCTCCGCTCTCAGACTACATGAACCTCAACCAGAG
TTCACACTCTTCTAAACTGTGTGAAATGAGTAGTCCCCTC
GATGGACTGCCAGAGCTGGCTGAATGCCCGCCTGATGATG
GGACTTGTTTTCTCAACGAACAGAGAAACTTACCATGCCC
CTCTGTATCAGGAAAAGGTAATTACACTGAGATGAGCTTC
AACAGTGGTTCCCTTGAAAATCAAAAGAGTGCTTCAGTCA
GCCCCACTAGCAGGGTTCAAAGGCTTAACTTGGGCAACCA
GGGGGTTTCAAAAGGAATTGGCGCTTTCTTGTTAGCTGCC
TCCTCTGTAGATCCAAACGGAGGAGCAAAGGTGATTCGAG
CAGACCCCCAGGGCCGGAGACGGCATAGCTCTGAGACCTT
TTCATCCACCACCACAGTTGCACCGGTCTTTCCCTCTTTT
GCACACAATGTTAAGCGACACAGCTCTGCCTCCGTAGAAA
ACATCTCAGTACGAAGCAGTGAAGGTTCTGATGAGGAGTA
TGAGTCTCCTATGTGCCAAGAAATGTCAGCTGGTTATCAA
AATGGGCTCAATTACATCGCCTTAAATCTCATGGAGAAAC
AAGAGACTGGCAATTGTGAAAATCTTGTGGGCTTTAAGAC
TGGCGGTTGTTGTAAAGCAGGAATAAATGGATTACACACA
ACTCCCTATGTGTGTCTTGGATTCAAAGAAACTGCAACCA
CTGTACAAGATTGAGCAGGAAGCAGAGGTTACTCCTAATG
CTAAGGGAAAATGGAAGCTCAACCATTAACTGGACTGAAC
TGGTTTGGTCTGGACTATGCTGCTGTAAATGAACCGTGAC
CTTTGCACCTCATCTTAAAGCTGAACGTCAGATGGATGTG
TTGTGAAAACTCCTACAAGGACAATGTGTTACTCCTGTTT
TTCCAATCTGCACCAATTTTTAAGCTGCTGCTCTTTTGTC
ATGAAATGTCATGAAATGAACTTTTATTGATGTTGTGAAA
ACCTTTAGTTTAATTTTGAAAATGTATTGCGTTATGATTT
ATTTTGCAATCTGTAAACTTATTTACCTGACCTAAATATC
TGAAAGGTACCATTTGCCCTGTTGTACGAATTGCCACGTG
TGTCATTTTAGTTATTTAAAAAGATTAGATTGAAAAGAAA
TCTATAAGTCCTCCCTGAGGAAATGATTTGTACTAATGCA
TGCATTTCAGAAGAGATAAACAATCATTTTAATTTGAATG
TTCTCATATGACCAATGCCTTACTCTCTTTGTTGACAAAT
TTATGACTTCTTATCTGGACCTAAACAATGAGAACATTTA
TTATACAACTCTATTTTTCTAAATATTTAGTTTATTAACT
AATCACTTAATAAGTTGCTACTTGAGAGCCCCTTTTTGAT
ATGGAGAATGTTTTGCCACCTTCTTACAGCAGGTGTGGTT
ACTGCACATGATATTTAATATTTACACAAATGATCTATTT
ATGACCATGGTCAATCTTTTGCTCCTATTTTTTCACAGAT
TAATTGTCACCTAAATCATAGCTTTTTTTTGTTCGACGGC
CTCATTTCACATGAATATATTTGAATTGTAATATAATGTA
TGGTAACAGTGACTGCTTCCCATTCCGACAGCATGTTGCC
AGTTAACTTGCCAAGAATAAAAAAATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations