Transcript

rnf175-202

ID
ZDB-TSCRIPT-090929-10053
Name
rnf175-202
Previous Names
  • rnf175-002
  • zgc:56665-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027499 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027499|OTTDARG00000021580|ZDB-GENE-040426-1104 rnf175|OTTDARP00000022526 DKEYP-75B4.3-002 LG_ BX548256.7 Danio rerio protein_coding KNOWN, 1519 bp
GACTCACAAGAATGATTCGCTCGTAATGGAACCGGAGCAG
AATGTCTGCCGGTAGAAACGGAGCCATTAATAGATGACCG
GAATCTAAACTGGTATTAATAATGGCCGGCCTGCAACCAC
AGGATGATCTTCTGAAAATGTCTCACAGAGAATCGTGGAA
GATGCAGCACGAGAGGCTACACGTGAAGCACAGAGGTCAT
GAGGCCATGCATGCAGAGATGGTCCTGATTCTCATCGCTA
CGCTAGTGGTCGCACAGATTGTCCTGGTTCAGTGGAAACA
AAGACACTGCAGATCCTACAATATGGTCACACTGCTGCAG
ATGTGGGTGGTTCCTCTCTACTTCACCATCAAGCTTTACT
GGTGGCGTTTTCTGTCCACATGGGGCATGTTCTCCGTCAT
CACCAGTTACGTCATATTCAGAGCCACACGCAAGCCTCTG
TCCTGCAGGACGCCACGGATGGTGTATAAGTGGTTCCTCC
TCATCTACAAGCTGAGCTATGCTGTGGGTGTGATTGGGTA
CCTCGCCATCATGTTCACCATGTTTGGATTCAACGTTTTC
TTCAGGATTAAAGCAGAGGACTCGATGGATGTGGGTGTGA
TCATGCTTTTCTATGGCTTGTATTATGGAGTGATGGGACG
TGATTTTGCAGAAATCTGCTCAGACTACATGGCGTCCACT
ATAGGGTACTATAACATGGGTGATATGCCATCCCGAAACC
TCAACAATGATGTGTGTGCCGTGTGCGGTCAGAAGATTTT
TGTGGATGTAGATGAGGAAGGCATTATTGAGGACACCTAT
CAGCTCTCCTGCAACCACACATTTCATGAATTCTGTATTC
GTGGCTGGTGCATCGTGGGAAAAAAGCAAACATGTCCATA
CTGCAATGAGAAAGTGGACCTCAAACGGATGATGAATAAC
CCCTGGGAGAGAACTCATGTTTTATACGGGCAGCTGCTGG
ACTGGCTCAGGTATCTGGTGGCCTGGCAGCCAATCATCAT
CGGAATCGTCCACGGGATAAACTTTTCACTCGGACTTGAA
TAAGCCTCTCCAGTATTTGATTCTGTTTACAGCTGTGCAT
GTGTTCACCTTTATAAATATTTATCAGAGAATTGTACACT
TTATAATATAAATCAGACAGCTGCTTTTGCTTTTTAATTT
ATTAGAAACATGGAACAGGCTTTTTTCAGAAGTGTCTTAA
TGCTGAAACAGAAGACGTACAGAAGCAAATCTAAACCTCT
TTTTATCACTCCTAATCCAGATTGTGCCTCATCTTGTTTG
TTCTGTTCATTTGTTGAATTGTGTAGCATTTGTTATGGTC
TGTTTTAAGTAGCTGTGAATTTTGAGTGGTTATGTTCTTA
CTGTATGTGTTTTTGTCTGTACAATGATGAGAGGTGAAGG
GGATTGCCAAAGGTGTACTGGAGTCAGTATTTTTTTGGTT
TATGTTGAGCCAAAAAAACATGTTTAACCCCATAATGCGC
TCCGTTTAAATTAAAACTATTTTCATGTGGCTACTGATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations