Transcript

rnf175-201

ID
ZDB-TSCRIPT-090929-10052
Name
rnf175-201
Previous Names
  • rnf175-001
  • zgc:56665-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027498 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027498|OTTDARG00000021580|ZDB-GENE-040426-1104 rnf175|OTTDARP00000022525 DKEYP-75B4.3-001 LG_ BX548256.7 Danio rerio protein_coding KNOWN, 1556 bp
GACTCACAAGAATGATTCGCTCGTAATGGAACCGGAGCAG
AATGTCTGCCGGTAGAAACGGAGCCATTAATAGATGACCG
GAATCTAAACTGGTATTAATAATGGCCGGCCTGCAACCAC
AGAATAAAGCAAGTCATAAAGGTTTGGAACCACTTGAGGG
ATGATCTTCTGAAAATGTCTCACAGAGAATCGTGGAAGAT
GCAGCACGAGAGGCTACACGTGAAGCACAGAGGTCATGAG
GCCATGCATGCAGAGATGGTCCTGATTCTCATCGCTACGC
TAGTGGTCGCACAGATTGTCCTGGTTCAGTGGAAACAAAG
ACACTGCAGATCCTACAATATGGTCACACTGCTGCAGATG
TGGGTGGTTCCTCTCTACTTCACCATCAAGCTTTACTGGT
GGCGTTTTCTGTCCACATGGGGCATGTTCTCCGTCATCAC
CAGTTACGTCATATTCAGAGCCACACGCAAGCCTCTGTCC
TGCAGGACGCCACGGATGGTGTATAAGTGGTTCCTCCTCA
TCTACAAGCTGAGCTATGCTGTGGGTGTGATTGGGTACCT
CGCCATCATGTTCACCATGTTTGGATTCAACGTTTTCTTC
AGGATTAAAGCAGAGGACTCGATGGATGTGGGTGTGATCA
TGCTTTTCTATGGCTTGTATTATGGAGTGATGGGACGTGA
TTTTGCAGAAATCTGCTCAGACTACATGGCGTCCACTATA
GGGTACTATAACATGGGTGATATGCCATCCCGAAACCTCA
ACAATGATGTGTGTGCCGTGTGCGGTCAGAAGATTTTTGT
GGATGTAGATGAGGAAGGCATTATTGAGGACACCTATCAG
CTCTCCTGCAACCACACATTTCATGAATTCTGTATTCGTG
GCTGGTGCATCGTGGGAAAAAAGCAAACATGTCCATACTG
CAATGAGAAAGTGGACCTCAAACGGATGATGAATAACCCC
TGGGAGAGAACTCATGTTTTATACGGGCAGCTGCTGGACT
GGCTCAGGTATCTGGTGGCCTGGCAGCCAATCATCATCGG
AATCGTCCACGGGATAAACTTTTCACTCGGACTTGAATAA
GCCTCTCCAGTATTTGATTCTGTTTACAGCTGTGCATGTG
TTCACCTTTATAAATATTTATCAGAGAATTGTACACTTTA
TAATATAAATCAGACAGCTGCTTTTGCTTTTTAATTTATT
AGAAACATGGAACAGGCTTTTTTCAGAAGTGTCTTAATGC
TGAAACAGAAGACGTACAGAAGCAAATCTAAACCTCTTTT
TATCACTCCTAATCCAGATTGTGCCTCATCTTGTTTGTTC
TGTTCATTTGTTGAATTGTGTAGCATTTGTTATGGTCTGT
TTTAAGTAGCTGTGAATTTTGAGTGGTTATGTTCTTACTG
TATGTGTTTTTGTCTGTACAATGATGAGAGGTGAAGGGGA
TTGCCAAAGGTGTACTGGAGTCAGTATTTTTTTGGTTTAT
GTTGAGCCAAAAAAACATGTTTAACCCCATAATGCGCTCC
GTTTAAATTAAAACTATTTTCATGTGGCTACTGATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations