Transgenic Construct
Tg(GFP,cryaa:mVenus)
- ID
- ZDB-TGCONSTRCT-240313-1
- Name
- Tg(GFP,cryaa:mVenus)
- Previous Names
-
- Tg(GFP-Sara) (1)
- Type
- engineered_plasmid
- Regulatory Regions
- Coding Sequences
- [Em λ][Ex λ]
- Fpbase:avGFP Fpbase:Venus
- Contains Sequences
- None
- Note
-
sequencing of GFP insertion with the following set of primers: forward ATCCTGCACTGAATGCACAC and backward CATGCTCGAGGAGAATTGGTGTGTCCGTTTC. Also, a sequence coding for mVenus under the expression of the Cryaa promoter was inserted in the intron 3 of the zfyve9a gene. You can track mVenus expression in the retina after 2 dpf to select positives embryos. GFP-zfyve9a is barely detectable under a fluorescent binocular. Insertion of GFP in front of the exon 2 of zfyve9a gene
Plasmid Map
None
Genomic Features
That Utilize Tg(GFP,cryaa:mVenus) Construct
Transgenics
That Utilize Tg(GFP,cryaa:mVenus) Construct
No data available
Sequence Information
Other Construct Pages
None
Citations