TALEN

TALEN1-paqr8

ID
ZDB-TALEN-210120-2
Name
TALEN1-paqr8
Previous Names
None
Target
Target Sequence 1
5' - GCTGAATGTGTGGACACACCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - GCGAAAAAAGAGAACTGCAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ecu13 paqr8
Expression
Gene expression in Wild Types + TALEN1-paqr8
No data available
Phenotype
Phenotype resulting from TALEN1-paqr8
No data available
Phenotype of all Fish created by or utilizing TALEN1-paqr8
Phenotype Fish Conditions Figures
oocyte stage III oocyte maturation decreased occurrence, abnormal paqr8ecu13/ecu13 (TU) chemical treatment by environment: (20R)-17,20-dihydroxypregn-4-en-3-one Fig. 1 from Wu et al., 2020
oocyte stage IV pgr expression decreased amount, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
unfertilized egg chorion decreased size, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions Fig. 6 with image from Wu et al., 2020
oocyte stage IV oocyte maturation decreased occurrence, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) chemical treatment by environment: (20R)-17,20-dihydroxypregn-4-en-3-one Fig. 2 with image from Wu et al., 2020
ovulation disrupted, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
oocyte stage IV lhcgr expression decreased amount, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
unfertilized egg yolk decreased size, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions Fig. 6 with image from Wu et al., 2020
oocyte stage III mmp2 expression decreased amount, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
oocyte stage IV oocyte maturation decreased rate of occurrence, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) chemical treatment by environment: (20R)-17,20-dihydroxypregn-4-en-3-one Fig. 2 with image from Wu et al., 2020
oocyte stage IV oocyte maturation increased occurrence, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) control Fig. 2 with image from Wu et al., 2020
ovary has extra parts of type oocyte stage I, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions Fig. 7 with image from Wu et al., 2020
oocyte stage IV oocyte maturation delayed, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) chemical treatment by environment: (20R)-17,20-dihydroxypregn-4-en-3-one Fig. 2 with image from Wu et al., 2020
whole organism brood size, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
ovary has extra parts of type oocyte stage II, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions Fig. 7 with image from Wu et al., 2020
ovary has fewer parts of type oocyte stage V, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
oocyte stage III pgr expression decreased amount, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
oocyte stage IV mmp2 expression decreased amount, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
oocyte stage III lhcgr expression decreased amount, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
oocyte stage IV adamts1 expression decreased amount, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
whole organism decreased fertility, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
ovary decreased size, abnormal paqr5aecu14/ecu14; paqr5becu15/ecu15; paqr6ecu16/ecu16; paqr7becu12/ecu12; paqr8ecu13/ecu13; paqr9ecu17/ecu17; paqr7aecu11/ecu11 (TU) standard conditions text only from Wu et al., 2020
yolk yolk granule disorganized, abnormal paqr5aecu14; paqr5becu15; paqr6ecu16; paqr7becu12; paqr8ecu13; paqr9ecu17; paqr7aecu11 (TU) standard conditions Fig. 6 with image from Wu et al., 2020
chorion decreased size, abnormal paqr5aecu14; paqr5becu15; paqr6ecu16; paqr7becu12; paqr8ecu13; paqr9ecu17; paqr7aecu11 (TU) standard conditions Fig. 6 with image from Wu et al., 2020
yolk decreased size, abnormal paqr5aecu14; paqr5becu15; paqr6ecu16; paqr7becu12; paqr8ecu13; paqr9ecu17; paqr7aecu11 (TU) standard conditions Fig. 6 with image from Wu et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.