TALEN

TALEN1-wdr62

ID

ZDB-TALEN-201201-3

Name

TALEN1-wdr62

Previous Names

None

Target

wdr62 (1)

Target Sequence 1

5' - TGAACCAAAGTTGTTTGACC - 3'

Target Sequence 2

5' - TGAAGTGCTGTTGTTGTTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ulb11	wdr62
ulb12	wdr62

Expression

Gene expression in Wild Types + TALEN1-wdr62

No data available

Phenotype

Phenotype resulting from TALEN1-wdr62

No data available

Phenotype of all Fish created by or utilizing TALEN1-wdr62

Phenotype	Fish	Conditions	Figures
whole organism viability, abnormal	aspm^ulb7/ulb7; wdr62^ulb11/ulb11	standard conditions	Fig. 4 from Duerinckx et al., 2019
pericardium edematous, abnormal	aspm^ulb7/ulb7; wdr62^ulb11/ulb11	standard conditions	Fig. 4 from Duerinckx et al., 2019
whole organism decreased length, abnormal	aspm^ulb7/ulb7; wdr62^ulb11/ulb11	standard conditions	Fig. 4 from Duerinckx et al., 2019
whole organism curved, abnormal	aspm^ulb7/ulb7; wdr62^ulb11/ulb11	standard conditions	Fig. 4 from Duerinckx et al., 2019
head decreased size, abnormal	aspm^ulb7/ulb7; wdr62^ulb11/ulb11	standard conditions	Fig. 4 from Duerinckx et al., 2019
whole organism decreased life span, abnormal	aspm^ulb7/ulb7; wdr62^ulb11/ulb11	standard conditions	Fig. 4 from Duerinckx et al., 2019
whole organism decreased length, abnormal	wdr62^ulb11/+; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism curved, abnormal	wdr62^ulb11/+; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
head decreased size, abnormal	wdr62^ulb11/+; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal	wdr62^ulb11/+; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal	wdr62^ulb11/+; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
pericardium edematous, abnormal	wdr62^ulb11/+; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism decreased length, abnormal	wdr62^ulb11/ulb11; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism curved, abnormal	wdr62^ulb11/ulb11; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal	wdr62^ulb11/ulb11; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
head decreased size, abnormal	wdr62^ulb11/ulb11; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal	wdr62^ulb11/ulb11; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
pericardium edematous, abnormal	wdr62^ulb11/ulb11; knl1^ulb9/ulb9	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism decreased length, abnormal	wdr62^ulb12/+; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal	wdr62^ulb12/+; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
head decreased size, abnormal	wdr62^ulb12/+; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal	wdr62^ulb12/+; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism curved, abnormal	wdr62^ulb12/+; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
pericardium edematous, abnormal	wdr62^ulb12/+; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal	wdr62^ulb12/ulb12; aspm^ulb8/ulb8	standard conditions	Fig. 4 from Duerinckx et al., 2019
head decreased size, abnormal	wdr62^ulb12/ulb12; aspm^ulb8/ulb8	standard conditions	Fig. 4 from Duerinckx et al., 2019
pericardium edematous, abnormal	wdr62^ulb12/ulb12; aspm^ulb8/ulb8	standard conditions	Fig. 4 from Duerinckx et al., 2019
whole organism decreased length, abnormal	wdr62^ulb12/ulb12; aspm^ulb8/ulb8	standard conditions	Fig. 4 from Duerinckx et al., 2019
whole organism curved, abnormal	wdr62^ulb12/ulb12; aspm^ulb8/ulb8	standard conditions	Fig. 4 from Duerinckx et al., 2019
whole organism decreased life span, abnormal	wdr62^ulb12/ulb12; aspm^ulb8/ulb8	standard conditions	Fig. 4 from Duerinckx et al., 2019
whole organism decreased length, abnormal	wdr62^ulb12/ulb12; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
pericardium edematous, abnormal	wdr62^ulb12/ulb12; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal	wdr62^ulb12/ulb12; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
head decreased size, abnormal	wdr62^ulb12/ulb12; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal	wdr62^ulb12/ulb12; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019
whole organism curved, abnormal	wdr62^ulb12/ulb12; knl1^ulb10/ulb10	standard conditions	Fig. S3 from Duerinckx et al., 2019

Citations