TALEN

TALEN1-pcdh10a

ID
ZDB-TALEN-190906-1
Name
TALEN1-pcdh10a
Previous Names
None
Target
Target Sequence 1
5' - TGGAGGGCTATCGCAGCTGC - 3'
Target Sequence 2
5' - TCCCCCGCTCCTGCTCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
co1000 pcdh10a
Expression
Gene expression in Wild Types + TALEN1-pcdh10a
No data available
Phenotype
Phenotype resulting from TALEN1-pcdh10a
No data available
Phenotype of all Fish created by or utilizing TALEN1-pcdh10a
Phenotype Fish Conditions Figures
whole organism pcdh8 expression increased amount, abnormal pcdh10aco1000/co1000 standard conditions Fig. S6 with image from Williams et al., 2018
whole organism pcdh18b expression increased amount, abnormal pcdh10aco1000/co1000 standard conditions Fig. S6 with image from Williams et al., 2018
neural tube dorsal region pcdh10a expression absent, abnormal pcdh10aco1000/co1000 standard conditions Fig. S3 with image from Williams et al., 2018
whole organism pcdh10b expression increased amount, abnormal pcdh10aco1000/co1000 standard conditions Fig. 5 with imageFig. S6 with image from Williams et al., 2018
trunk pcdh10b expression increased amount, abnormal pcdh10aco1000/co1000 standard conditions Fig. 5 with image from Williams et al., 2018
whole organism pcdh10a expression absent, abnormal pcdh10aco1000/co1000 standard conditions Fig. S3 with image from Williams et al., 2018
solid lens vesicle pcdh10a expression absent, abnormal pcdh10aco1000/co1000 standard conditions Fig. S3 with image from Williams et al., 2018
melanophore stripe morphology, abnormal pcdh10aco1000/co1000 standard conditions Fig. 3 with imageFig. 5 with image from Williams et al., 2018
whole organism pcdh10a expression decreased amount, abnormal pcdh10aco1000/co1000 standard conditions Fig. S6 with image from Williams et al., 2018
head pcdh10a expression decreased amount, abnormal pcdh10aco1000/co1000 standard conditions Fig. 3 with image from Williams et al., 2018
whole organism pcdh19 expression increased amount, abnormal pcdh10aco1000/co1000 standard conditions Fig. S6 with image from Williams et al., 2018
melanocyte mislocalised, abnormal pcdh10aco1000/co1000 standard conditions Fig. 3 with imageFig. 5 with image from Williams et al., 2018
neural tube dorsal region pcdh10a expression decreased amount, abnormal pcdh10aco1000/co1000 standard conditions Fig. 3 with image from Williams et al., 2018
migratory neural crest cell aggregated, abnormal pcdh10aco1000/co1000; vu234Tg; w47Tg standard conditions Fig. 4 with image from Williams et al., 2018
post-vent region curved, abnormal pcdh10aco1000/co1000 + MO2-pcdh10b standard conditions Fig. 5 with image from Williams et al., 2018
post-vent region morphology, abnormal pcdh10aco1000/co1000 + MO2-pcdh10b standard conditions Fig. 5 with image from Williams et al., 2018
melanophore stripe morphology, abnormal pcdh10aco1000/co1000 + MO2-pcdh10b standard conditions Fig. 5 with image from Williams et al., 2018
melanocyte mislocalised, abnormal pcdh10aco1000/co1000 + MO2-pcdh10b standard conditions Fig. 5 with image from Williams et al., 2018
melanophore stripe melanocyte decreased amount, abnormal pcdh10aco1000/co1000 + MO2-pcdh10b standard conditions Fig. 5 with image from Williams et al., 2018
post-vent region curved, abnormal pcdh10aco1000/co1000; pcdh10bco1009/co1009 standard conditions Fig. 5 with image from Williams et al., 2018
melanophore stripe morphology, abnormal pcdh10aco1000/co1000; pcdh10bco1009/co1009 standard conditions Fig. 5 with image from Williams et al., 2018
melanocyte mislocalised, abnormal pcdh10aco1000/co1000; pcdh10bco1009/co1009 standard conditions Fig. 5 with image from Williams et al., 2018
Citations