TALEN

TALEN1-klf2b

ID
ZDB-TALEN-190604-2
Name
TALEN1-klf2b
Previous Names
None
Target
Target Sequence 1
5' - GGCACTGAACACAGACAC - 3'
Target Sequence 2
5' - TGCTGAGATCCTCGTCATCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns12 klf2b
Expression
Gene expression in Wild Types + TALEN1-klf2b
No data available
Phenotype
Phenotype resulting from TALEN1-klf2b
No data available
Phenotype of all Fish created by or utilizing TALEN1-klf2b
Phenotype Fish Conditions Figures
cardiac muscle cell protruding out of compact layer of ventricle, exacerbated klf2abns11/+; klf2bbns12/bns12; s883Tg chemical treatment by environment: SU5402 Fig. 6 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis decreased process quality, exacerbated klf2abns11/+; klf2bbns12/bns12; s883Tg chemical treatment by environment: SU5402 Fig. 6 with image from Rasouli et al., 2018
heart edematous, abnormal klf2abns11/bns11; klf2bbns12/bns12 standard conditions Fig. 1 with image from Rasouli et al., 2018
ventricular endocardium MAPK cascade decreased occurrence, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns7Tg standard conditions Fig. 6 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis decreased process quality, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns7Tg standard conditions Fig. 6 with image from Rasouli et al., 2018
cardiac muscle cell protruding out of compact layer of ventricle, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns7Tg standard conditions Fig. 6 with image from Rasouli et al., 2018
ventricular endocardium ab9-mapk labeling decreased amount, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns7Tg standard conditions Fig. 6 with image from Rasouli et al., 2018
ventricular myocardium cell population proliferation decreased occurrence, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns7Tg; ncv43Tg standard conditions Fig. 3 with image from Rasouli et al., 2018
cardiac muscle cell protruding out of compact layer of ventricle, abnormal klf2abns11/bns11; klf2bbns12/bns12; hsc4Tg; s974Tg standard conditions Fig. 2 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis decreased process quality, abnormal klf2abns11/bns11; klf2bbns12/bns12; hsc4Tg; s974Tg standard conditions Fig. 2 with image from Rasouli et al., 2018
cardiac ventricle cardiac muscle contraction arrested, abnormal klf2abns11/bns11; klf2bbns12/bns12; hsc4Tg; s974Tg chemical treatment by environment: diacetylmonoxime Fig. 2 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis process quality, ameliorated klf2abns11/bns11; klf2bbns12/bns12; hsc4Tg; s974Tg chemical treatment by environment: diacetylmonoxime Fig. 2 with image from Rasouli et al., 2018
cardiac muscle cell located in compact layer of ventricle, ameliorated klf2abns11/bns11; klf2bbns12/bns12; hsc4Tg; s974Tg chemical treatment by environment: diacetylmonoxime Fig. 2 with image from Rasouli et al., 2018
atrium cardiac muscle contraction arrested, abnormal klf2abns11/bns11; klf2bbns12/bns12; hsc4Tg; s974Tg chemical treatment by environment: diacetylmonoxime Fig. 2 with image from Rasouli et al., 2018
ventricular myocardium apical plasma membrane EGFP expression mislocalised, abnormal klf2abns11/bns11; klf2bbns12/bns12; hsc4Tg; zf517Tg standard conditions Fig. 3 with image from Rasouli et al., 2018
cardiac muscle cell mislocalised radially, abnormal klf2abns11/bns11; klf2bbns12/bns12; s883Tg standard conditions Fig. 1 with image from Rasouli et al., 2018
cardiac muscle cell protruding out of compact layer of ventricle, abnormal klf2abns11/bns11; klf2bbns12/bns12; s883Tg standard conditions Fig. 1 with imageFig. 5 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis decreased process quality, abnormal klf2abns11/bns11; klf2bbns12/bns12; s883Tg standard conditions Fig. 1 with imageFig. 5 with image from Rasouli et al., 2018
cardiac muscle cell protruding out of compact layer of ventricle, abnormal klf2abns11/bns11; klf2bbns12/bns12; s974Tg standard conditions Fig. 1 with imageFig. 2 with image from Rasouli et al., 2018
cardiac muscle cell mislocalised radially, abnormal klf2abns11/bns11; klf2bbns12/bns12; s974Tg standard conditions Fig. 1 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis decreased process quality, abnormal klf2abns11/bns11; klf2bbns12/bns12; s974Tg standard conditions Fig. 1 with imageFig. 2 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis decreased process quality, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns200Tg; s883Tg standard conditions Fig. 5 with image from Rasouli et al., 2018
cardiac muscle cell protruding out of compact layer of ventricle, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns200Tg; s883Tg standard conditions Fig. 5 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis decreased process quality, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns234Tg; s883Tg standard conditions Fig. 5 with image from Rasouli et al., 2018
cardiac muscle cell protruding out of compact layer of ventricle, abnormal klf2abns11/bns11; klf2bbns12/bns12; bns234Tg; s883Tg standard conditions Fig. 5 with image from Rasouli et al., 2018
heart morphology, ameliorated klf2abns11/bns11; klf2bbns12/bns12; bns235Tg standard conditions Fig. 5 with image from Rasouli et al., 2018
cardiac ventricle morphology, ameliorated klf2abns11/bns11; klf2bbns12/bns12; bns235Tg standard conditions Fig. 5 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis process quality, ameliorated klf2abns11/bns11; klf2bbns12/bns12; bns235Tg standard conditions Fig. 5 with image from Rasouli et al., 2018
ventricular endocardium MAPK cascade occurrence, ameliorated klf2abns11/bns11; klf2bbns12/bns12; bns235Tg; s883Tg standard conditions Fig. 6 with image from Rasouli et al., 2018
cardiac muscle cell located in compact layer of ventricle, ameliorated klf2abns11/bns11; klf2bbns12/bns12; bns235Tg; s883Tg standard conditions Fig. 5 with imageFig. 6 with image from Rasouli et al., 2018
ventricular endocardium ab9-mapk labeling amount, ameliorated klf2abns11/bns11; klf2bbns12/bns12; bns235Tg; s883Tg standard conditions Fig. 6 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis process quality, ameliorated klf2abns11/bns11; klf2bbns12/bns12; bns235Tg; s883Tg standard conditions Fig. 5 with imageFig. 6 with image from Rasouli et al., 2018
cardiac muscle cell located in compact layer of ventricle, ameliorated klf2abns11/bns11; klf2bbns12/bns12; s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
cardiac ventricle cardiac muscle contraction arrested, abnormal klf2abns11/bns11; klf2bbns12/bns12; s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
ventricular myocardium ventricular cardiac muscle tissue morphogenesis process quality, ameliorated klf2abns11/bns11; klf2bbns12/bns12; s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
atrium cardiac muscle contraction arrested, abnormal klf2abns11/bns11; klf2bbns12/bns12; s974Tg + MO1-tnnt2a standard conditions Fig. 2 with image from Rasouli et al., 2018
Citations