TALEN

TALEN1-kctd15b

ID
ZDB-TALEN-180508-3
Name
TALEN1-kctd15b
Previous Names
None
Target
Target Sequence 1
5' - CAGCAGGCTGTTTAAC - 3'
Target Sequence 2
5' - TGCTGCTTTAAACTGTCCAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
y585 kctd15b
Expression
Gene expression in Wild Types + TALEN1-kctd15b
No data available
Phenotype
Phenotype resulting from TALEN1-kctd15b
No data available
Phenotype of all Fish created by or utilizing TALEN1-kctd15b
Phenotype Fish Conditions Figures
neural crest foxd3 expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 1 with image from Heffer et al., 2017
neural crest sox10 expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 1 with image from Heffer et al., 2017
whole organism kctd15a expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. S1 from Heffer et al., 2017
neural plate border dlx3b expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 1 with image from Heffer et al., 2017
barbel absent, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. S6 with image from Heffer et al., 2017
neural crest sox9b expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 1 with image from Heffer et al., 2017
dentary decreased length, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 4 with image from Heffer et al., 2017
migratory neural crest cell zgc:91968 expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 2 with image from Heffer et al., 2017
whole organism decreased length, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 5 with image from Heffer et al., 2017
maxilla decreased length, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 4 with image from Heffer et al., 2017
cranial cartilage morphology, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 4 with image from Heffer et al., 2017
xanthophore increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 3 with image from Heffer et al., 2017
neural crest snai1b expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 1 with image from Heffer et al., 2017
torus lateralis absent, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 6 with image from Heffer et al., 2017
migratory neural crest cell tyrp1a expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 2 with image from Heffer et al., 2017
neural crest tfap2a expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 1 with image from Heffer et al., 2017
head pigment cell gch2 expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 3 with image from Heffer et al., 2017
melanocyte tyrp1a expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 2 with image from Heffer et al., 2017
frontal bone decreased length, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 4 with image from Heffer et al., 2017
melanocyte increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 2 with image from Heffer et al., 2017
maxilla malformed, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 4 with image from Heffer et al., 2017
whole organism kctd15b expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. S1 from Heffer et al., 2017
melanocyte zgc:91968 expression increased amount, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) control Fig. 2 with image from Heffer et al., 2017
whole organism decreased size, abnormal kctd15ay584/y584; kctd15by585/y585 (AB) standard conditions Fig. 5 with image from Heffer et al., 2017
migratory neural crest cell increased amount, abnormal kctd15ay584/y584; kctd15by585/y585; ba2Tg control Fig. 1 with image from Heffer et al., 2017
Citations