TALEN

TALEN1-galt

ID
ZDB-TALEN-180302-1
Name
TALEN1-galt
Previous Names
None
Target
Target Sequence 1
5' - TTTTGGTCTCGGCCCATCGG - 3'
Target Sequence 2
5' - TTTCTCCACCTGTCCTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf2028 galt
zf2029 galt
Expression
Gene expression in Wild Types + TALEN1-galt
No data available
Phenotype
Phenotype resulting from TALEN1-galt
No data available
Phenotype of all Fish created by or utilizing TALEN1-galt
Phenotype Fish Conditions Figures
whole organism UTP:galactose-1-phosphate uridylyltransferase activity decreased process quality, abnormal galtzf2028/zf2028 standard conditions Fig. 2 with imageFig. 3 with image from Delnoy et al., 2022
skeletal muscle UDP-glucose:hexose-1-phosphate uridylyltransferase activity arrested, abnormal galtzf2028/zf2028 control Fig. S3 from Vanoevelen et al., 2017
female organism decreased female fertility, abnormal galtzf2028/zf2028 control Fig. 4 from Vanoevelen et al., 2017
whole organism UDP-N-acetyl-D-galactosamine decreased amount, abnormal galtzf2028/zf2028 standard conditions Fig. 3 from Haskovic et al., 2020
brain UDP-glucose:hexose-1-phosphate uridylyltransferase activity arrested, abnormal galtzf2028/zf2028 control Fig. 3 from Vanoevelen et al., 2017
unfertilized egg decreased amount, abnormal galtzf2028/zf2028 control Fig. 4 from Vanoevelen et al., 2017
whole organism alpha-D-galactose 1-phosphate increased amount, abnormal galtzf2028/zf2028 chemical treatment: galactose Fig. 3 from Vanoevelen et al., 2017
ovary UDP-glucose:hexose-1-phosphate uridylyltransferase activity arrested, abnormal galtzf2028/zf2028 control Fig. 3 from Vanoevelen et al., 2017
whole organism UDP-N-acetyl-alpha-D-glucosamine decreased amount, abnormal galtzf2028/zf2028 standard conditions Fig. 3 from Haskovic et al., 2020
whole organism alpha-D-galactose 1-phosphate increased amount, abnormal galtzf2028/zf2028 chemical treatment by environment: galactose Fig. 4 with image from Delnoy et al., 2022
whole organism alpha-D-galactose 1-phosphate increased amount, abnormal galtzf2028/zf2028 standard conditions Fig. 4 with image from Delnoy et al., 2022
whole organism galactonate increased amount, abnormal galtzf2028/zf2028 chemical treatment by environment: galactose Fig. 4 with image from Delnoy et al., 2022
gonad CDP-ribitol increased amount, abnormal galtzf2028/zf2028 standard conditions Fig. 2 from Haskovic et al., 2020
whole organism UDP-N-acetyl-D-galactosamine decreased amount, abnormal galtzf2028/zf2028 chemical treatment by environment: galactose Fig. 3 from Haskovic et al., 2020
male organism decreased male fertility, abnormal galtzf2028/zf2028 control Fig. 4 from Vanoevelen et al., 2017
whole organism UDP-N-acetyl-alpha-D-glucosamine decreased amount, abnormal galtzf2028/zf2028 chemical treatment by environment: galactose Fig. 3 from Haskovic et al., 2020
whole organism decreased behavioural activity, abnormal galtzf2028/zf2028 control Fig. 4 from Vanoevelen et al., 2017
whole organism galactose metabolic process decreased process quality, abnormal galtzf2028/zf2028 control Fig. 2 from Vanoevelen et al., 2017
whole organism galactonate increased amount, abnormal galtzf2028/zf2028 standard conditions Fig. 4 with image from Delnoy et al., 2022
skeletal muscle UDP-glucose:hexose-1-phosphate uridylyltransferase activity arrested, abnormal galtzf2029/zf2029 control Fig. S3 from Vanoevelen et al., 2017
female organism decreased female fertility, abnormal galtzf2029/zf2029 control Fig. 4 from Vanoevelen et al., 2017
whole organism UDP-N-acetyl-D-galactosamine decreased amount, abnormal galtzf2029/zf2029 standard conditions Fig. 3 from Haskovic et al., 2020
whole organism alpha-D-galactose 1-phosphate increased amount, abnormal galtzf2029/zf2029 chemical treatment: galactose Fig. 3 from Vanoevelen et al., 2017
brain UDP-glucose:hexose-1-phosphate uridylyltransferase activity arrested, abnormal galtzf2029/zf2029 control Fig. 3 from Vanoevelen et al., 2017
unfertilized egg decreased amount, abnormal galtzf2029/zf2029 control Fig. 4 from Vanoevelen et al., 2017
ovary UDP-glucose:hexose-1-phosphate uridylyltransferase activity arrested, abnormal galtzf2029/zf2029 control Fig. 3 from Vanoevelen et al., 2017
whole organism UDP-N-acetyl-alpha-D-glucosamine decreased amount, abnormal galtzf2029/zf2029 standard conditions Fig. 3 from Haskovic et al., 2020
gonad CDP-ribitol increased amount, abnormal galtzf2029/zf2029 standard conditions Fig. 2 from Haskovic et al., 2020
whole organism galactose metabolic process decreased process quality, abnormal galtzf2029/zf2029 control Fig. 2 from Vanoevelen et al., 2017
male organism decreased male fertility, abnormal galtzf2029/zf2029 control Fig. 4 from Vanoevelen et al., 2017
whole organism decreased behavioural activity, abnormal galtzf2029/zf2029 control Fig. 4 from Vanoevelen et al., 2017
whole organism UDP-N-acetyl-alpha-D-glucosamine decreased amount, abnormal galtzf2029/zf2029 chemical treatment by environment: galactose Fig. 3 from Haskovic et al., 2020
whole organism UDP-N-acetyl-D-galactosamine decreased amount, abnormal galtzf2029/zf2029 chemical treatment by environment: galactose Fig. 3 from Haskovic et al., 2020
Citations